Labshake search
Citations for Mirus Bio :
51 - 100 of 195 citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: HEK293T cells were seeded at 1.5-2 × 105 cells/well in 24-well plates the day before transfection using TransIT-LT1 reagent at 1.5μL transfection reagent/well (Mirus Bio LLC). 100 ng of indicated constructs encoding a N-terminal mCherry tagged CARD8 were co-transfected into HEK293T cells with either 400 ng of pcDNA3.1 empty vector (‘–‘) ...
-
bioRxiv - Microbiology 2022Quote: HeLa cells were seeded in 6 well plates (2.0×105 per well) and incubated overnight before transfection with pCAGGS-VP40 using lipofectamin LT-1 (MIR2304; Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... low passage cells were plated at a density of 25,000 cells per well in a 96-well plate and transfected at > 80% confluence with all-in-one PiggyBac plasmids containing CasRx using TransIT-X2 (MIR 6003, Mirus) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... For the complementation assay 100ng of total DNA (1:1 ratio of plasmids) was transfected into 293T cells in 96-well plates using TansIT(R)-LT1 (Mirus) transfection reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in a 100 mm plate overnight and plasmids (15 μg) were transfected using 45 μl of TransIT-LT1 (Mirus). The cells were cultured for 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... in 24-well plates were transfected with 0.5 µg of plasmid DNA per well using TransIT-LT1 transfection reagent (Mirus Bio) in OptiMEM (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v1 or hDel-v2 lentiviral sgRNA library at a target infection rate of 25% ...
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Cell Biology 2022Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg of total DNA and 8 mL TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Genomics 2022Quote: ... in HK-2 human proximal tubule cells at approximately 70% confluency in 96-well plates by using TransIT-2020 Reagent (Mirus, #5404), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... and NP proteins (23) were transfected into 50% confluent HEK293T cells in 6-well plates with TransIT-LT1 transfection reagent (Mirus Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Korea) at a density of 1.0 × 105 cells/well in a 96-well plate using TransIT-X2 (Mirus Bio, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Viral particles were produced by transfection of 293FT cells in 6-well plates with 3 μg DNA and 8 μl TransIT-293 Transfection Reagent (Mirus Bio) per well ...
-
bioRxiv - Microbiology 2020Quote: ... Confluent monolayers of BHK-T7 cells in 12-well plates were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.27 μg of each of eleven plasmid constructs representing the SA11 rotavirus genome and of each of two plasmids encoding vaccinia virus mRNA capping enzymes ...
-
bioRxiv - Microbiology 2022Quote: ... were seeded into 6-well plates and transfected the next day with 200 ng pcDNA4/TO-RNR-3×FLAG using TransIT-LT1 (Mirus #2304). A3B-EGFP or A3A-EGFP expression was induced 6 hours after transfection with 50 ng/mL doxycycline ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μg pVSVG per 1 reaction in a 6-well plate well) into HEK 293T cells with TransIT-LT1 transfection reagent (Mirus #2304) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and were transfected into early passage NIH-3T3 cells in 6 well plates using TransIT-X2® dynamic delivery transfection system (Mirus). Viruses from cell culture supernatants were passaged on M2-10B4 cells followed by virus purification and titration [3] ...
-
bioRxiv - Bioengineering 2023Quote: ... Motor neuron progenitors were sparsely cultured on a 24-well plate and one day after passaging transfected using Mirus LT1 (Mirus Bio) transfection reagent ...
-
bioRxiv - Developmental Biology 2023Quote: ... Neuro2a cells were seeded in 24-well plates at 80,000 cells per well and on the next day were transfected with TransIT-LT1 Transfection Reagent (Mirus, MIR 2300), using 150 ng luciferase reporter ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were cultured in T175 cm2 plates to 85–90% confluency and transfected with the target vectors (10 µg/plate) using TransIT-X2® dynamic delivery transfection reagent (#MIR6006, Mirus). After 48 hours post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and Ingenio® electroporation kit (#50117, Mirus). After 5 days of transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and Ingenio® electroporation kit (#50117, Mirus), and seeded onto a 35-mm petri dish with No ...
-
bioRxiv - Neuroscience 2020Quote: ... with the Ingenio electroporation kit (Mirus Bio). The concentration of plasmids we used was 10μg with 100 μl of Ingenio electroporation solution ...
-
bioRxiv - Microbiology 2022Quote: ... using TransIT-mRNA Transfection Kit (Mirus Bio) at 33°C (61) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ingenio® electroporation kit (Mirus, #50117). After 1 day ...
-
bioRxiv - Microbiology 2023Quote: ... using TransIT-mRNA Transfection Kit (Mirus Bio), or treated with TransIT transfection alone (carrier control) ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a TransIT-X2 transfection kit (Mirus). Tether radius was obtained by comparing tether fluorescence to fluorescence counts from a known area of the parent cell membrane ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... were plated at 2 × 105 cells/mL in 2 mL in 6-well plates one day prior to transfection using TransIT-LT1 reagent (Mirus Bio LLC) with 3 μL of transfection reagent per μg of DNA ...
-
bioRxiv - Microbiology 2021Quote: Transient transfection experiments were performed in six-well plates at 2.5 × 105 HEK 293 T cells per well using TransIT®-LT1 transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions unless indicated.
-
bioRxiv - Cell Biology 2022Quote: ... constructs were packaged into lentivirus in a 10 cm plate 60% confluent of HEK293T cells using the TransIT-LT1 (Mirus Bio, MIR2300) transfection reagent and 7 μg of the vector ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in 6-well plates or 10-cm dishes and allowed to reach ~70% confluency before transient transfection using TransIT-2020 (Mirus, catalog #: 5400), or siRNA treatment (50 nM ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of BHK-T7 cells at ~50% confluency in 6-well plates were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg of each of ten plasmid constructs representing the T1L or T3DI reovirus genome ...
-
bioRxiv - Microbiology 2022Quote: 293T cells were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 3 μL transfection reagent/well as previously described 57 ...
-
bioRxiv - Microbiology 2022Quote: HEK293T were seeded at 2 × 105 cells/well in 6-well plates the day before transfection using TransIT-LT1 reagent (Mirus Bio LLC) at 5.8 μL transfection reagent/well ...
-
bioRxiv - Microbiology 2022Quote: 3×105cells were seeded in 6-well plates and transfected with 3CLpro plasmids via TransIT-PRO (Mirus Bio LLC, Madison, WI, USA) and incubated overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... 300,000 cells were seeded in 6-well plates and transfected 24hrs later with 2ug of pBS-(CBR-TCR(PTC))-(CBG-TCR(WT)) plasmid68 using TransIT-LT1® (Mirus, MIR2300), following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 x 105 293T cells per well were seeded in 6-well plates and transfected one day later with GFP-Mpro-L plasmids using TransIT-pro (Mirus Bio LLC). After 10 hours ...
-
bioRxiv - Microbiology 2023Quote: 3 x 105 cells were seeded per well in 6-well plates and transfected one day after seeding with 3CLpro plasmids using TransIT-PRO (Mirus Bio LLC) and incubated 8-9 hours for Mpro-On and 10 hours for Mpro-Off assays ...
-
bioRxiv - Immunology 2024Quote: ... constructs were packaged into lentivirus in a 10 cm plate 60% confluent of HEK293T cells using the TransIT-LT1 (Mirus Bio, MIR2300) transfection reagent and 7Lμg of the vector ...
-
bioRxiv - Bioengineering 2022Quote: ... was labelled with Label It DNA kit (Mirus), following the manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... or the Ingenio electroporation kit (Mirus, #MIR 50117) with 1.5 µg of either control siRNA (ON-TARGETplus Non-Targeting Pool ...
-
bioRxiv - Immunology 2020Quote: TransIT®-mRNA Transfection Kit (Mirus Bio LLC);
-
bioRxiv - Microbiology 2022Quote: ... using the TransIT-mRNA Transfection Kit (Mirus bio). To stimulate signaling ...
-
bioRxiv - Microbiology 2022Quote: ... using the TransIT-mRNA Transfection Kit (Mirus bio). To induce IFN-β ...
-
bioRxiv - Immunology 2023Quote: ... followed by the MiraCLEAN Endotoxin Removal Kit (Mirus) to ensure efficient removal of endotoxin ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2024Quote: ... the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at 10:7.5:5 ratio using TransIT-293 Transfection Reagent (MIR2704, Mirus) according to the manufacturer’s instructions ...