Labshake search
Citations for Mirus Bio :
51 - 100 of 271 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2021Quote: ... and 1 μg of PiggyBac transposase expression vector (total = 3 μg) using TransIT-LT1 (Mirus Bio, Madison, WI, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-N-MYC-BioID2-rat mTOR (rmTOR) using the TransIT-X2 transfection reagent (Mirus) according to the manufacturer’s specification ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Cell Biology 2023Quote: ... cells were plated in 6-well dishes and transfected with mEGFP-tagged DNAJC17 or deletion mutants using TransIt-LT1 reagent at a 3:1 ratio (Mirus). Cells were then trypsinized and replated on 4-well chambered coverglass (LabTek ...
-
bioRxiv - Cell Biology 2023Quote: ... was then transfected into SH-SY5Y cells (50-60% confluent) in a 6-well plate using TransIT LT-1 reagent (Mirus Bio, Cat# MIR-2300). After 48 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... before adding 6 µl of TransIT VirusGen transfection reagent (Mirus MIR6700). The transfection mixture was incubated for 10 to 15 min and then added dropwise to HEK293T cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with either Fugene 6 or with TransIT-LT1 (Mirus). For knockdown experiments ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6×105 cells were resuspended in 100 μL Ingenio Electroporation Solution (Mirus), and RNP complex with either 100 pmol ssODN or 7.5 μg plasmid donor DNA was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 6-well plates by using TransIT-293 transfection reagent (Mirus #MIR2705) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL TransIT-LT1 transfection reagent (Mirus Bio) was mixed with 15 µL Opti-MEM (Thermo ...
-
bioRxiv - Biophysics 2022Quote: ... and 3 μL of TransIt LT1 (Mirus #MIR2305). Stable clones were selected by growing in DMEM containing 0.5 μg/μL puromycin (Sigma-Aldrich #P8833-25MG ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were transfected with 1 μg of in vitro-transcribed J6/JFH-1 Rluc RNA or H77S.3/GLuc RNA using the TransIT mRNA transfection kit (Mirus Bio LLC) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cells were transfected with 3 µg of either each GPC expression plasmid or pCAGGS empty vector using TransIT LT-1 reagent (Mirus, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then transiently transfected 1 µg pTA-Luc-NL4-3 and different amounts of pEGFP-SF2 using TransIT®-LT1 transfection reagent (Mirus Bio LLC) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids for expression of kinesin-1 or any of the kinesin-6 family motors tagged with monomeric NeonGreen and an FRB domain were cotransfected into COS-7 cells with a plasmid for expression of PEX3-mRFP-FKBP or GMAP210p-mRFP-2xFKBP at a ratio of 5:1 with TransIT-LT1 transfection reagent (Mirus). Eighteen hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... Medium was changed 24 h later to 10 ml of 5 % FBS/DMEM and changed again 48 h later to 10 ml of 5 % FBS/DMEM containing 1 µg/ml of puromycin (Mirus). Cells were incubated in selection medium for 72 h ...
-
bioRxiv - Microbiology 2023Quote: ... and 6 μl of TransIT-X2 Dynamic Delivery System (Mirus Bio; #MIR 6000). Following incubation at room temperature for 25 min ...
-
bioRxiv - Microbiology 2022Quote: ... 3 ul of TransIT-LT1 reagent (Mirus Bio LLC) transfection agent was used per ug of DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl Mirus TransIT-LT1 transfection reagent (Mirus #MIR2300), and up to 1 µg of plasmid DNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and mRFP + Nuak 1 and 2 kinases was performed via chemical transfection using TransIT-X2 (Mirus Bio, Madison, WI) 48 hours following plating ...
-
bioRxiv - Cancer Biology 2023Quote: ... Control and BCAT1-KO U251 cells were reverse-transfected with 1µg/ml of TC3-R9P-3NLS pDNA using 1:2 of Trans-iT (Mirus). 48h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentiviral particles were produced by co-transfection of shRNA plasmids with psPAX and pMDG.2 in 293T cells using the Trans-IT LT-1 transfection reagent (Mirus). DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of TransIT-X2® transfection reagent (Mirus Bio) was then added to the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were transfected with the N-terminal FLAG-tagged CDC42 expression vector using TransIT 293 (Mirus Bio LLC) in 6-well culture plates ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors were produced in HEK-293T cells by co-transfection of the previously sequenced vector constructs with psPAX and pMDG.2 packaging plasmids using Trans-IT LT-1 (Mirus, MIR2700). HEK293T cells were incubated overnight at 37°C and the next day medium was changed for IMDM 10% HI-FBS ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Cell Biology 2024Quote: ... and either 3 µl Mirus TransIT-X2 transfection reagent (Mirus #MIR6000) for hTERT-RPE1 cells ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Cell Biology 2021Quote: ... which expresses green fluorescent protein fused to the N-terminus of activated K-Ras4B (250 ng per well of 12 well) with HeLa Monster (Mirus), per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Immunology 2022Quote: ... Primers were designed for the predicted coding region of Bma-LEC-1 and Bma-LEC-2 that incorporated restriction digest sites facilitating recombination into the pOETIC 6xHis Transfer Plasmid (Mirus Bio, Madison, WI) (Supplemental Materials 1) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Cell Biology 2022Quote: ... The following day 3 µl of Mirus TransIT 2020 reagent (Mirus Bio, Madison, WI) and 1 µg of plasmid were combined in 250 µl Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: HEK 293T cells (106) were transfected in 6-well plates with corresponding plasmids with Transit LT1 transfection reagent (Mirus) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells (150 cm2 dish) were transfected with 6 μg of each protein-coding plasmid by using TransIT (Mirus). Cell lysis and elution were performed as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... 150 μL pre-warmed OPTI-MEM was placed in 1.5 mL tubes with 6 μL TransIT-LT1 transfection reagent (MIR 2300, Mirus), vortexed briefly ...
-
bioRxiv - Immunology 2019Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3µg DNA and 8µl TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Immunology 2022Quote: Viral particles were produced by transfection of HEK293FT cells in 6-well plates with 3μg DNA and 8μL TransIT-293 (Mirus Bio) per well ...
-
bioRxiv - Zoology 2022Quote: ... Four µg of either plasmid were transfected into 6 × 105 C6/36 cells using TransIT-2020 transfection reagent (Mirus) for 4 h ...
-
bioRxiv - Immunology 2023Quote: 293T cells were seeded in 6-well plates at 0.2M cells/ml and were transfected with TransIT-LT1 (Mirus) 24h later with 1500 ng of empty plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... followed by transfection 6 hours post seeding using different EBOV plasmids and TransIT-LT1 transfection reagent (Mirus Bio LLC) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... they were transfected with 1800 ng of plasmid containing either N- or C-terminal tagged GFP-AMPKγ3 using TransITx2 transfection reagent (Mirus Bio, cat no. MIR 6000) and then lysed 48 hours later (lysis buffer – 50 mM Tris ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded into 14.5 cm dishes and transfected with 40 µg pTK-SM-N100-GFP-V5 expression vector using TransIT-2020 (Mirus Bio; 1 µg DNA: 2 µL reagent), delivered in Opti-MEM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 µL of TransIT mRNA reagent (Mirus Bio). Transfection reactions were incubated at room temperature for 3 minutes prior to drop-wise addition into each well ...
-
bioRxiv - Microbiology 2019Quote: ... HEK293 cells in 6 well plates were transfected with 500 ng/well of each protein-coding plasmid by using TransIT (Mirus). After 48 h ...
-
bioRxiv - Microbiology 2019Quote: ... MHV68 was produced by first making p0 virus by transfecting NIH 3T3 cells in 6-well plates with 2.5 μg BAC DNA using TransIT-X2 (Mirus Bio) for 24h ...