Labshake search
Citations for Mirus Bio :
51 - 100 of 143 citations for 6 Oxo 5 6 7 8 tetrahydronaphthalene 2 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... resuspended in v3.1 medium supplemented with 2 μM thiazovivin and 5 μg/ml polybrene (Mirus, MIR 6620), transduced with the hDel-v3 lentiviral sgRNA library at a target infection rate of 10% ...
-
bioRxiv - Developmental Biology 2023Quote: ... COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: COS-7 cells were transfected with Trans-IT LT1 (Mirus) according to the manufacturer’s instructions and collected 48 h post-transfection ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 8 µL of Trans-IT LT1 (Mirus, #2300) was added to Opti-MEM (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... COS-7 cells were transfected using TransIT-LT1 transfection reagent (Mirus). Cells are checked annually for mycoplasma contamination.
-
bioRxiv - Genomics 2021Quote: ... and the appropriate pLKO-derived vector (at ratios of 8 µg, 1 µg, and 8 µg, respectively, per 15 cm dish) with Trans-LT1 (Mirus Bio, Madison WI), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... were transfected with 2·5 µg serine protease expression plasmid or empty vector using TransIT-X2 Dynamic Delivery System (Mirus). One day later ...
-
bioRxiv - Cell Biology 2022Quote: ... using 8 μl of TransIT-293 (Mirus Bio #MIR 2705) transfection reagent per well ...
-
bioRxiv - Cancer Biology 2022Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
bioRxiv - Biophysics 2020Quote: ... Transfection of COS-7 cells was performed with TransIT-X2 transfection reagent (Mirus Bio, US) according to manufacturer’s instructions 24 hours after cell seeding and at least 22 hours before fixation ...
-
bioRxiv - Biophysics 2021Quote: ... 7 μg of DNA was mixed with 21 μL of Trans-IT LT1 transfection reagent (Mirus) or LipoD transfection reagent and 1750 μL DMEM and incubated at RT for 20 minutes to allow formation of DNA/transfection reagent complexes before addition to the cells ...
-
bioRxiv - Microbiology 2021Quote: A ~7 kb PCR product was fluorescently labeled as described previously11 using the Cy3 LabelIT kit (Mirus Biosciences) as per manufacturer recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... 8×106 cells were suspended in 800 μl Ingenio® Electroporation Solution (Mirus Bio, Madison, WI) and mixed with 10 μg RNA in a 4-mm cuvette ...
-
bioRxiv - Genetics 2020Quote: WT or mutant mini-genes were transfected in triplicates into COS-7 and ARPE-19 cells using TransIT-LT1 Transfection Reagent (Mirus). Cells were harvested 36h after transfection and total RNA was extracted using Quick-RNA MiniPrep Plus kit (ZYMO Research) ...
-
bioRxiv - Neuroscience 2023Quote: ... COS-7 cells cultured on coverslips were transfected with the indicated expression vectors using TransIT-LT1 Transfection Reagent (Mirus bio) and maintained for 24 h ...
-
bioRxiv - Cell Biology 2019Quote: ... 8 µg pCMV-dR8.91 and 1 µg pMD2.G packaging plasmids using 48 µl TransIT-LT1 (Mirus). Plasmid DNA was mixed with transfection reagent in Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μL of TransIT-LT1 (Mirus), and the transfection was performed as per manufacturer’s directions ...
-
bioRxiv - Biophysics 2020Quote: 1μg of recombinant Plexin-B1 FL WT pCDNA 3.1 plasmid or Plexin-B1 FL mutants pCDNA 3.1 (as described above) was transfected to 80% confluent COS 7 cells on coverslips using 3 μL Trans IT 2020 transfection reagent (Mirus Bio) for 48 hours at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Monolayers of ∼ 8 × 105 BHK-T7 cells were co-transfected using TransIT-LT1 transfection reagent (Mirus Bio LLC) with 0.8 μg each of nine plasmid constructs representing the T1L reovirus genome plus a single parental or mutant pBacT7-S1 plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... or 2 µg of pPol1II-HA and 2 µg of pPol1II-NA) using TransIT-293 (Mirus). Virus supernatant was harvested 72 hours post-transfection and filtered through 0.22 µm filters ...
-
bioRxiv - Genomics 2019Quote: ... were used to transfect 1 × 106 Huh-7 cells using the TransIT® mRNA transfection kit according to the manufacturer’s instructions (Mirus Bio LLC). At 72 h post transfection (p.t.) ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus). Afterward ...
-
bioRxiv - Microbiology 2022Quote: ... or 2:2:1 (33) with TransIT®-LT1 transfection reagent (Mirus Bio LLC, Madison, WI, USA) and the plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed on 150 mm dishes (8 per condition) using Mirus TransIT®-LT1 Transfection Reagent (Mirus Bio) and Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL of Boost reagent (Mirus Bio) and 2 µL of TransIT mRNA reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (32) ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G at a ratio of 9:8:1 by mass using TransIT-LT1 transfection reagent (Mirus MIR 2306) at a ratio of 3 μL transfection reagent per 1 μg plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB-mCherry plasmid was mixed with the pCMV_ΔR8.91 and pMD2.G packaging vectors at a ratio of 9:8:1 with TransIT®-Lenti Transfection Reagent (Mirus) in optiMEM (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: BHK-21 cells were transfected in 25 cm2 flasks with 8 µg per flask of infectious clone-derived RNA using TransIT transfection reagent (Mirus) as described previously (35) ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to the cells ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 µl of TransIT-mRNA Reagent (Mirus Bio). The reaction mixture was incubated for 5 min at room temperature and added to cell monolayers ...
-
bioRxiv - Immunology 2021Quote: ... transfected with 44 μg plasmid encoding SARS-CoV-2 Spike (pCG1-SARS-2-S, Wuhan Hu-1) using Transit LT-1 (Mirus). The next day ...
-
bioRxiv - Microbiology 2022Quote: ... 293T cells on 96-well plate were co-transfected with a set of pGS-AVLQS and pSARS-CoV-2 Mpro or a set of pGS-RLKGG and pSARS-CoV-2 PLpro using TranIT-LT1 (Mirus Bio) in the presence of serial diluted S-217622 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 µL of TransIT mRNA reagent (Mirus Bio). Transfection reactions were incubated at room temperature for 3 minutes prior to drop-wise addition into each well ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µg pSINrep21/YFV NS1 plasmid DNA was transfected into BHK-21 clone 15 cells by using 8 µl TransIT LT1 reagent (Mirus Bio, Wisconsin, MD) and low-serum OptiMem (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were transferred into cuvettes (2 mm gap, Mirus, MIR50121) and subjected for electroporation using Nucleofector2b (Lonza) ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... and 5 μl Trans-IT®LT-1 transfection reagent (Mirus, USA) for 20 min ...
-
bioRxiv - Neuroscience 2021Quote: ... using 2 μL of TransIT-Insect transfection reagent (Mirus Bio Cat #6104). Medium was replaced with serum-containing medium 5 hours after transfection ...
-
bioRxiv - Biophysics 2022Quote: ... with ∼ 600ng DNA and 2 µL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 2 µg of plasmid DNA was transfected per dish using Transit 293T (Mirus) following the manufacturer’s instructions and measured at least 48 h later.
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 5 μg of pACT-GFP-actin using TransIT-Insect transfection reagent (Mirus Bio) and incubated for 2 d at 28°C in Grace’s media with 10% FBS and antibiotics (100 μg/ml penicillin/streptomycin and 0.25 μg/ml Amphotericin B) ...
-
bioRxiv - Biophysics 2023Quote: ... at a dye:basepair ratio 1:5 using the Mirus Label IT Nucleic Acid Labeling Kit (Mirus Bio).
-
bioRxiv - Biophysics 2022Quote: ... with 600 – 1000 ng DNA and 2 μL TransIT-LT1 transfection reagents (Mirus Bio Corporation) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 250 μl of OptiMEM media and supplemented with 2 μl TransIT-2020 Transfection Reagent (Mirus, MIR5400). The transfection mix was incubated 20 min at room temperature and then added to the cell culture for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... On day 2 cells were transfected with lentiviral DNA following the Mirus-LT1 (Mirus MIR 2300) transfection protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... together with the packaging plasmids psPAX2 (UK1701) and pMD2.G (UK1700) at a 10:7.5:5 ratio using TransIT-293 reagent (Mirus). The supernatant containing the viral particles was collected 48 hrs after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus). Afterward ...