Labshake search
Citations for TriLink BioTechnologies :
1 - 50 of 122 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... PCR product synthesized with N4-methyl-dCTP (4mdCTP; Trilink) using primers JZ294/JZ295 (Table S5 ...
-
bioRxiv - Biochemistry 2024Quote: The cystamine-functionalized DNA oligonucleotide (5’-GTAGTGXTTTGTCGTCTCATCTGTATGCGTC, where X denotes the N4-cystamine-2’-deoxycytidine) was synthesized by TriLink Biotechnologies ...
-
bioRxiv - Genomics 2023Quote: ... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5-Methoxyuridine-5’- Triphosphate (Trilink, N-1093), 5-Methylcytidine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5-Methylcytidine-5’-Triphosphate (Trilink, N-1014). Following the in vitro transcription ...
-
bioRxiv - Synthetic Biology 2021Quote: ... pseudouridine-5′-triphosphate (ΨTP) and 5-methylcytidine-5′-triphosphate (m5CTP) (both from TriLink BioTechnologies) were used instead of natural UTP and CTP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink, N-1081) was substituted for the standard uridine triphosphate included in the HiScribe Kit for certain reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and N1-Methylpseudouridine-5’-Triphosphate (Trilink, N-1081-5) to replace UTP ...
-
bioRxiv - Immunology 2024Quote: ... N1-methylpseudouridine-5’-triphosphate (m1Ψ-5′-triphosphate) (TriLink #N-1081) instead of uridine-5’-triphosphate (UTP ...
-
bioRxiv - Immunology 2024Quote: ... N1-methylpseudouridine-5’-triphosphate (m1Ψ-5′-triphosphate) (TriLink #N-1081) instead of uridine-5’-triphosphate (UTP) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM N1-methylpseudouridine-5’-triphosphate (TriLink® BioTechnologies, TRN1081), 4 mM CleanCap® AG reagent (TriLink® BioTechnologies ...
-
bioRxiv - Immunology 2021Quote: ... m7(3OMeG)(5′)ppp(5′)(2OMeA)pG (Cat: N-7113, TriLink), and of N1-methylpseudouridine-5’-triphosphate (Cat ...
-
bioRxiv - Immunology 2022Quote: ... m7(3OMeG)(5⍰)ppp(5⍰)(2OMeA)pG (Cat: N-7113, TriLink), and of N1-methylpseudouridine-5’-triphosphate (Cat ...
-
bioRxiv - Bioengineering 2022Quote: ... however 2 μl of the appropriate canonical NTP (75 mM) was replaced by 2 μl of 100 mM 5-Hydroxymethyl-5’-triphosphate (e.g. 5-Hydroxymethyl-CTP) (TriLink).
-
bioRxiv - Molecular Biology 2024Quote: ... The GTP nucleotide solution was used at a final concentration of 3.0 mM instead of 7.5 mM and the anti-reverse cap analog N7-Methyl-3’-O-Methyl-Guanosine-5’-Triphosphate- 5’-Guanosine (ARCA, Trilink) was used at a final concentration of 12.0 mM resulting in a final ratio of Cap:GTP of 4:1 that allows efficient capping of the mRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... or CTP was fully substituted with 5-methylcytidine-5’-triphosphate (TriLink Biotechnologies) in the in vitro transcription reactions ...
-
bioRxiv - Immunology 2021Quote: ... and 5-Methylcytidine (Trilink). The template for in vitro transcription was a PCR amplicon from the pLMCT-RBD-6His produced using the PHUSION high fidelity DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... m1Ψ-5’-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Immunology 2022Quote: ... m1Ψ-5’-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNAs ...
-
bioRxiv - Bioengineering 2024Quote: ... m1Ψ-5′-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Immunology 2022Quote: ... m1Ψ-5’-triphosphate (TriLink) was used instead of UTP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... m1Ψ-5′-triphosphate (TriLink) was incorporated instead of UTP ...
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 5’-O-(1-thiotriphosphate) and 3’-deoxycytidine 5’-triphosphate were from TriLink. Adenosine 5’-O-(1-thiotriphosphate ...
-
bioRxiv - Biochemistry 2022Quote: ... CleanCap Fluc mRNA and CleanCap 5 Fluc mRNA (5-methoxyuridine) were purchased from TriLink Biotechnologies.
-
bioRxiv - Immunology 2022Quote: ... and m1Ψ-5’- triphosphate (TriLink) was incorporated into the reaction instead of UTP ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-methylpseudouridine-5′-triphosphate (TriLink) was used instead of UTP to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Immunology 2022Quote: ... and m1Ψ-5’-triphosphate (TriLink) was incorporated into the reaction instead of UTP ...
-
bioRxiv - Immunology 2022Quote: ... CleanCap 5’ cap structures (TriLink) were incorporated into the 5′ end co-transcriptionally ...
-
bioRxiv - Synthetic Biology 2024Quote: N1-methylpseudouridine-5’-Triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Biochemistry 2024Quote: ... 5-formyl dCTP (TriLink Biotechnologies) or 5-carboxy-dCTP (TriLink Biotechnologies) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pseudouridine-5’-Triphosphate (N-1019, Trilink) and Inosine-5’-Triphosphate (N-1020 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pseudouridine triphosphate (Trilink Biotechnologies, N1019-5) was substituted for uridine triphosphate at an equivalent concentration ...
-
bioRxiv - Immunology 2020Quote: ... One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Bioengineering 2023Quote: ... and m1Ψ-5’-triphosphate (Trilink biotechnologies) instead of uridine bases ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pseudouridine-5’-Triphosphate (Trilink, N- 1019), N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Bioengineering 2024Quote: ... N1-methylpseudouridine (m1Ψ)-5′-triphosphate (TriLink) instead of Uridine-5′-triphosphate (UTP ...
-
bioRxiv - Biochemistry 2024Quote: ... or 5-carboxy-dCTP (TriLink Biotechnologies). The PCR cycle number and individual step times were as those for canonical DNA synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... where uridine-5ʹ-triphosphate was replaced by 5-methoxyuridine-5′-triphosphate (TriLink BioTechnologies, San Diego, CA, USA). IVT-mRNAs were then purified using a Monarch RNA clean up kit (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
bioRxiv - Bioengineering 2020Quote: ... 5′-Biotin-G-Monophosphate (TriLink, #N-6003) at a 20 mM (final concentration ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and Inosine-5’-Triphosphate (N-1020, Trilink) were used in place of uridine and guanosine ...
-
bioRxiv - Molecular Biology 2021Quote: ... pseudouridine-5’-triphosphate (TriLink Biotechnologies, N-1019) or N1-methylpseudouridine-5’-triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... N1-Methylpseudouridine-5’-Triphosphate (Trilink, N-1081), 5-Methoxyuridine-5’- Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... or N1-Methylpseudouridine-5’-Triphosphate (TriLink Biotechnologies), or CTP was fully substituted with 5-methylcytidine-5’-triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-AA-2’-dUTP (TriLink, N-2049), DAPI (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... CleanCap™ Cy5 eGFP mRNA (5-methoxyuridine) and CleanCap™ eGFP mRNA (5- methoxyuridine) (996 nucleotides) were from TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2020Quote: ... 2’-Fluoro-2’-deoxycytidine-5’-Triphosphate (2’F-dCTP) and 2’-Fluoro-2’-deoxyuridine-5’-Triphosphate (2’F-dUTP) were purchased from Trilink Biotechnologies ...
-
bioRxiv - Immunology 2022Quote: ... so that the in vitro transcribed mRNA has an authentic 5’-end of the alphavirus and can be 5’-capped by TriLink BioTechnologies’ CleanCap Technology (Henderson et al. ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer instructions with the following modifications: Cytidine triphosphate and uracil triphosphate were replaced with 5-methyl-cytidine triphosphate and 5-methoxyuridine triphosphate (Trilink). mRNAs were purified using the Monarch RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: ... 5 mM N1-methylpseudouridine (TriLink, N-1081-1), 4 mM CleanCap AG (TriLink ...