Labshake search
Citations for TriLink BioTechnologies :
51 - 100 of 103 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The CleanCap Reagent AG (3′ OMe) (TriLink; cat. no. N-7413) was added to the in vitro transcription reaction mixture for co-transcriptional 5′-end capping ...
-
bioRxiv - Immunology 2023Quote: ... ψ-UTP (TriLink, San Diego, CA, USA; cat. no. N-1019) was used to substitute for UTP to prepare ψ-UTP-incorporated mRNA ...
-
bioRxiv - Genomics 2023Quote: ... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
bioRxiv - Neuroscience 2022Quote: ... or Cas9 mRNA (1000 ng/μl) (TriLink BioTechnologies), sgRNA (30 ng/μl ...
-
bioRxiv - Neuroscience 2022Quote: ... Cas9 mRNA (100 ng/uL. Trilink, L-6125) and both sgRNAs (100 ng/uL each ...
-
bioRxiv - Genetics 2023Quote: ... and Cas9 Nickase mRNA (Trilink; 100 ng/μl) in injection buffer ...
-
bioRxiv - Genetics 2024Quote: ... and Cas9 Nickase mRNA (Trilink; 100 ng/μl) in injection buffer ...
-
bioRxiv - Physiology 2021Quote: ... and CleanCap® Reagent AG (6 mM, N-7113, TriLink Biotechnologies, USA) (Zangi et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... ATP was replaced by N6-Methyladenosine-5’-Triphosphate(m6ATP) (Trilink-N-1013;) for the IVT reaction of m6A-modified RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... UTP was replaced with either pseudouridine-5’-triphosphate (N-1019, TriLink Biotechnologies) or N1-Methylpseudouridine-5’-Triphosphate (N-1081 ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences (20 ng/μL) and its corresponding donor oligonucleotide (100 ng/μL) were co-microinjected with Cas9 nickase mRNA (50 ng/μL, Trilink Biotechnologies) into the cytoplasm of zygotes collected from B6D2F1/J mice (JAX #100006) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng CleanCap Cas9 (5moU) mRNA (Trilink, L-7206) was electroporated into the cells using the Neon™ Transfection System (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... UTP was replaced with One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink, Cat# N-1081) for producing nucleoside-modified mRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Genetics 2021Quote: Base editor mRNA (evoCDAmax-SpCas9-NG) was provided by TriLink Biotechnologies ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.
-
bioRxiv - Molecular Biology 2021Quote: ... GTP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) and synthesized in vitro as described in RNA preparation ...
-
bioRxiv - Biochemistry 2022Quote: ... The transcription reactions contained 0.5 mM of each NTPs and additional 4sUTP (TriLink N-1025) added in proportion to the number of Us in each transcript ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mixes containing 100 ng/µl Cas9 mRNA (5meC,Ψ) (TriLink BioTechnologies), 50 ng/µl sgRNAs and 50 ng/µl ssODN or 50 ng/µl lssDNA were prepared in microinjection buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... ABE8e-NG and BE4max were ordered as custom products from Trilink Biotechnologies ...
-
bioRxiv - Systems Biology 2023Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Immunology 2023Quote: ... for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies, # N-7113-1). For large-scale mRNA production ...
-
bioRxiv - Genomics 2024Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of Cas9 mRNA (50 ng/ µl, #L-6125, TriLink Biotechnologies) and two specific gRNAs (25 ng/ µl each ...
-
bioRxiv - Molecular Biology 2021Quote: ... GTP or ATP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) or 7-deaza-ATP (TriLink ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Neuroscience 2023Quote: ... RNP complexes were supplemented with 500 ng EGFP mRNA (Trilink Biotechnologies, L-7201) per well ...
-
bioRxiv - Systems Biology 2023Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Genomics 2024Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Bioengineering 2021Quote: ... and 20 µg of an RNA library (TriLink BioTechnologies, San Diego, CA) of 1012 random 20-nucleotide sequences was electroporated into a range of three to six million cells using the NEON Transfection System (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 30 pg - 1 ng of eGFP spike-in RNA (TriLink Biotechnologies L-7601-100), vortexed ...
-
bioRxiv - Genomics 2022Quote: ... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
bioRxiv - Genetics 2020Quote: ... mice were microinjected with 50 ng/μl of wild type Cas9 mRNA (TriLink Biotechnologies, San Diego, CA), 50 ng/μl of sgRNA (Synthego Corp. ...
-
bioRxiv - Biophysics 2020Quote: ... except each nucleotide was present at a final concentration of 4 mM and the reaction was supplemented with 6 mM of 5’-biotin-G-Monophosphate (Trilink, #N-6003). Reactions were incubated at 37 °C for 2 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... N1-methylpseudouridine substituted RNAs were produced by the complete replacement of uridine triphosphate in the T7 transcription reaction with N1-methylpseudouridine triphosphate (Trilink N-1081). Uridine and N1-methylpseudouridine RNAs were then mixed in equimolar ratios prior to in vitro translation.
-
bioRxiv - Molecular Biology 2023Quote: ... UTP was replaced with 20% pseudouridine-5ʹ-triphosphate (TriLink, USA; final concentration, 7.5 mM) by mixing the reagents with 40 ng/µL of linearized SINEUP RNA ...
-
bioRxiv - Immunology 2019Quote: ... Mice were generated by injection of a mixture of mammalian optimized Cas9 mRNA (100 ng/μl, TriLink Biotechnologies), purified gRNA_16 and gRNA_23 (50 ng/μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNAs (20ng/ul each) were co-microinjected with Cas9 mRNA (50 ng/ul, purchased from Trilink Biotechnologies) into the cytoplasm of zygotes collected from B6D2F/J F1 hybrid mice (JAX Stock No ...
-
bioRxiv - Cell Biology 2021Quote: ... 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N [methoxy (polyethyleneglycol)-2000] (DMPE-PEG2000, NOF Corporation) and contained CleanCap® Enhanced Green Fluorescent Protein (eGFP) mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7201) and/or Clean Cap®Cyanine5 (Cy5 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 ng was used as template for initial error-prone PCR using 8-oxo-GTP and dPTP (TriLink Biotechnologies). Four 50 µl PCR reactions were performed on each template with increasing concentrations of mutagenic nucleotides (5 µM ...
-
Nucleo-cytoplasmic shuttling of splicing factor SRSF1 is required for development and cilia functionbioRxiv - Molecular Biology 2020Quote: ... Gene editing was performed by microinjection of RNA encoding the wild-type Cas9 nuclease (50 ng/μl, TriLink BioTechnologies, #L7606), 25 ng/μl single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and CpG 2 µg/ml (TriLink) were added in a final volume of 100 µl ...
-
bioRxiv - Molecular Biology 2019Quote: Equal amounts of total RNA (100 ng) were used for small RNA library preparation using the CleanTag small RNA library preparation kit (TriLink Biotechnologies). Adapter-ligated libraries were reverse transcribed and amplified (19 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions testing IRES nLuc reporters were additionally supplemented with 50 ng/µL (final) competitor FFLuc mRNA (TriLink Biotechnologies # L-7602-100) to increase the fidelity of the IRES nLuc signal ...
-
bioRxiv - Immunology 2023Quote: ... was prepared in injection buffer by mixing 500 ng/μl of each of the sgRNAs (left and right) with Cas9 mRNA (1 μg/μl, TriLink, cat # L-6125). Fertilized eggs collected from B6/129 mice were microinjected at the CHOP transgenic core and transferred into pseudo-pregnant B6 females ...
-
bioRxiv - Systems Biology 2019Quote: eGFP mRNA and eGFP mRNA with Cy5 label nucleotides (996 nucleotides, 1 mg/mL in 10 mM Tris-HCl and pH 7.5) were purchased from TriLink Biotechnologies ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transduced activation reporter cells were enriched by puromycin selection (1µg mL-1) following nucleofection of dCas9-VPR mRNA (TriLink) and a Cas9 sgRNA targeting the ESR protospacer (IDT) ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was plaque-purified on Vero CCL81 cells in the presence of 25 μg/ml of cytosine arabinoside (TriLink BioTechnologies), and plaques in agarose plugs were amplified on Vero CCL81 cells ...