Labshake search
Citations for TriLink BioTechnologies :
1 - 50 of 72 citations for Anti Selenoprotein N Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 5hmdUTP (N-2059) and 5hmCTP (N-1087) were purchased from Trilink Biotechnologies.
-
bioRxiv - Bioengineering 2019Quote: ... dPTP (TriLink, N-2037), 8-oxo-dGT (TriLink ...
-
bioRxiv - Immunology 2023Quote: ... with substitution of N-1-methyl-pseudouridine-5’-triphosphate (TriLink Biotechnologies, #N-1081-1) for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2019Quote: ... 8-oxo-dGT (TriLink, N-2034), each at 400 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... ppGpp (Trilink Biotechnologies, Cat#N-6001), GpCpp (Jena Bioscience ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Pseudouridine-5’-Triphosphate (N-1019, Trilink) and Inosine-5’-Triphosphate (N-1020 ...
-
bioRxiv - Microbiology 2020Quote: ... 2’-F-2’-dUTP (N-1010-1) and didanosine-TP (N-4017-1) were purchased from Trilink. Remdesivir-DP was synthesized by WuXi AppTech ...
-
bioRxiv - Bioengineering 2020Quote: ... 5′-Biotin-G-Monophosphate (TriLink, #N-6003) at a 20 mM (final concentration ...
-
bioRxiv - Molecular Biology 2022Quote: ... with addition of m6ATP (TriLink, N-1013) instead of ATP nucleotides in the reaction mix ...
-
bioRxiv - Genomics 2022Quote: ... 4 mM CleanCap AG (TriLink, N-7113), 1 unit/μL Murine RNase Inhibitor (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and Inosine-5’-Triphosphate (N-1020, Trilink) were used in place of uridine and guanosine ...
-
bioRxiv - Molecular Biology 2021Quote: ... and phosphorylated 4-thiouridine (TriLink, N-1025). Different strands of pre-mRNA were generated for each construct that included different quantities of 4sU ...
-
bioRxiv - Molecular Biology 2021Quote: ... pseudouridine-5’-triphosphate (TriLink Biotechnologies, N-1019) or N1-methylpseudouridine-5’-triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μM dPTP (TriLink BioTechnologies; N-2037), and 2.5 U Taq polymerase in Thermopol Reaction Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... with complete substitution of uridine to 1- methylpseudouridine and CleanCap AG analog (N-1081 and N-7113, TriLink Biotechnologies).
-
bioRxiv - Microbiology 2020Quote: ... The standards Am and m6Am 5’ monophosphate were generated by digesting their triphosphate forms (TriLink N-1015 and N-1112) with 1 unit Apyrase (NEB M0398).
-
bioRxiv - Genomics 2021Quote: ... 0.5 mM 3′-azido-ddGTP (Trilink, #N-4008), 0.2 mM S-adenosylmethionine (SAM ...
-
bioRxiv - Genomics 2022Quote: ... 5 mM N1-methylpseudouridine (TriLink, N-1081-1), 4 mM CleanCap AG (TriLink ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 7-deaza-ATP (TriLink, N-1061-1) during in vitro transcription using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... and m1-pseudouridine-5’-triphosphate (TriLink, N-1081). Template DNA was digested with Turbo DNase ...
-
bioRxiv - Bioengineering 2024Quote: ... and m1-pseudouridine-5’-triphosphate (TriLink, N-1081). Template DNA was digested with Turbo DNase ...
-
bioRxiv - Biochemistry 2022Quote: ... by adding 2.5 μL each of 20 μM 8-oxo-dGTP TriLink Biotechnologies N-2034) and 20 μM dPTP (TriLink Biotechnologies N-2037) to a 50 μL Taq polymerase (Fisher Scientific 50-811-694 ...
-
bioRxiv - Physiology 2021Quote: ... N1-Methylpseudo-UTP (7.5 mM, N-1081, TriLink Biotechnologies), and CleanCap® Reagent AG (6 mM ...
-
bioRxiv - Bioengineering 2022Quote: ... and 10 mM m1Ψ (TriLink, Cat#N-1019-1). The IVT reaction can be scaled down by a half ...
-
bioRxiv - Biochemistry 2020Quote: ... 3’dUTP (ref N-3005) was purchased from Trilink. Quant-it Picogreen® dsDNA assay kit (ref P11496 ...
-
bioRxiv - Molecular Biology 2021Quote: ... or N1-methylpseudouridine-5’-triphosphate (TriLink Biotechnologies, N-1081) were used to replace regular UTP ...
-
bioRxiv - Biochemistry 2021Quote: ... Inosine-5′-Triphosphate (ITP; TriLink Biotechnologies, Cat#N-1020), ppGpp (Trilink Biotechnologies ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μM 8-oxo-dGTP (TriLink BioTechnologies, N-2034), 2 μM dPTP (TriLink BioTechnologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... or N1-Methylpseudouridine-5’-Triphosphate (N-1081, TriLink Biotechnologies). For the uridine-depleted sequences (RNA6 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink, N-1081) was substituted for the standard uridine triphosphate included in the HiScribe Kit for certain reactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and N1-Methylpseudouridine-5’-Triphosphate (Trilink, N-1081-5) to replace UTP ...
-
bioRxiv - Immunology 2021Quote: ... and of N1-methylpseudouridine-5’-triphosphate (Cat: N-1081, TriLink) in place of uridine-5’-triphosphate (UTP) ...
-
bioRxiv - Immunology 2022Quote: ... with UTP substituted by m1Ψ-5’-triphosphate (TriLink, #N-1081). A donor methyl group S-adenosylmethionine was added to the methylated capped RNA (cap 0) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Me-CTP (100 mM, TriLink; Cat. No. N-1014-1) and pseudo-UTP (100mM ...
-
bioRxiv - Immunology 2022Quote: ... and of N1-methylpseudouridine-5’-triphosphate (Cat: N-1081, TriLink) in place of uridine-5’-triphosphate (UTP) ...
-
bioRxiv - Immunology 2022Quote: ... Nucleoside-5’-Triphosphate (NTP) Set (TriLink cat. no. N-1505), T7 RNA polymerase (New England BioLabs cat ...
-
bioRxiv - Systems Biology 2024Quote: ... co-transcriptionally capped with CleanCap Reagent AG (TriLink N-7113), treated with TURBO DNase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... m7(3OMeG)(5′)ppp(5′)(2OMeA)pG (Cat: N-7113, TriLink), and of N1-methylpseudouridine-5’-triphosphate (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... and replacing UTP with 1-methylpseudouridine triphosphate (N-1081, TriLink Biotechnologies) as previously described(14) ...
-
bioRxiv - Immunology 2022Quote: ... m7(3OMeG)(5⍰)ppp(5⍰)(2OMeA)pG (Cat: N-7113, TriLink), and of N1-methylpseudouridine-5’-triphosphate (Cat ...
-
bioRxiv - Immunology 2023Quote: ... The CleanCap Reagent AG (3′ OMe) (TriLink; cat. no. N-7413) was added to the in vitro transcription reaction mixture for co-transcriptional 5′-end capping ...
-
bioRxiv - Immunology 2023Quote: ... ψ-UTP (TriLink, San Diego, CA, USA; cat. no. N-1019) was used to substitute for UTP to prepare ψ-UTP-incorporated mRNA ...
-
bioRxiv - Genomics 2023Quote: ... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
bioRxiv - Physiology 2021Quote: ... and CleanCap® Reagent AG (6 mM, N-7113, TriLink Biotechnologies, USA) (Zangi et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... ATP was replaced by N6-Methyladenosine-5’-Triphosphate(m6ATP) (Trilink-N-1013;) for the IVT reaction of m6A-modified RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... UTP was replaced with either pseudouridine-5’-triphosphate (N-1019, TriLink Biotechnologies) or N1-Methylpseudouridine-5’-Triphosphate (N-1081 ...
-
bioRxiv - Microbiology 2021Quote: ... UTP was replaced with One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink, Cat# N-1081) for producing nucleoside-modified mRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.