Labshake search
Citations for TriLink BioTechnologies :
101 - 122 of 122 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Uridine 5’-triphosphate (UTP) was replaced with the triphosphate derivative of m1Ψ (m1ΨTP) (TriLink, San Diego, CA, USA Biotechnologies) in the transcription reaction ...
-
Evaluation of mRNA-LNP and adjuvanted protein SARS-CoV-2 vaccines in a maternal antibody mouse modelbioRxiv - Immunology 2023Quote: ... diproline-modified spike protein from the SARS-CoV-2 Wuhan-Hu-1 strain were produced as previously described15,16 with m1Ψ-5-triphosphate (TriLink) instead of UTP and capped cotranscriptionally using the trinucleotide cap1 analog ...
-
bioRxiv - Biochemistry 2024Quote: The cystamine-functionalized DNA oligonucleotide (5’-GTAGTGXTTTGTCGTCTCATCTGTATGCGTC, where X denotes the N4-cystamine-2’-deoxycytidine) was synthesized by TriLink Biotechnologies ...
-
bioRxiv - Microbiology 2020Quote: ... The standards Am and m6Am 5’ monophosphate were generated by digesting their triphosphate forms (TriLink N-1015 and N-1112) with 1 unit Apyrase (NEB M0398).
-
bioRxiv - Immunology 2024Quote: ... Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies) to generate a natural Cap 1 structure ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at ∼70% confluency and reverse transfected with indicated concentrations of mRNA-Cas9-HA containing 5-methoxyuridine (5moU) or mRNA-eGFP 5moU (TriLink) in MessengerMAX (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... For the 3xFLAG-RLuc and 3xFLAG-HBB reporter 0.8 mM CleanCap reagent AG (TriLink Biotechnologies, Cat No. N-7113-5) was included in the reaction ...
-
bioRxiv - Immunology 2021Quote: ... 5′ amino-oligonucleotides were conjugated directly to each antigen using the SoluLINK Protein-Oligonucleotide Conjugation Kit (TriLink cat no. S-9011) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 5’amino-oligonucleotides were conjugated directly to each antigen using the Solulink Protein-Oligonucleotide Conjugation Kit (TriLink cat no. S-9011) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 5’amino-oligonucleotides were conjugated directly to each antigen using the Solulink Protein-Oligonucleotide Conjugation Kit (TriLink cat no. S-9011) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Short mitochondrial DNA fragments (221bp) were amplified from gDNA from A549 cells with and without 8-Oxo-2’-deoxyguanosine-5’-Triphosphate (TriLink Biotechnologies) using GoTaq Mastermix ...
-
bioRxiv - Immunology 2020Quote: ... 5’amino-oligonucleotides were conjugated directly to each antigen using the Solulink Protein-Oligonucleotide Conjugation Kit (TriLink cat no. S-9011) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 21-mer-sd or 21-mer-d 3′ and 14-mer 5′ ends vRNAs (IBA) were used in combination with synthetic 12-or 13-mer capped RNA (TriLink Biotechnologies) as primer (Table 2 ...
-
bioRxiv - Genomics 2022Quote: ... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
bioRxiv - Cancer Biology 2024Quote: ... according to the manufacturer’s recommended protocol for high-yield synthesis with the following changes: UTP was fully replaced with N1-methylpseudouridine-5′-triphosphate (TriLink Biotechnologies) and co-transcriptional capping by CleanCap Reagent AG (TriLink Biotechnologies ...
-
bioRxiv - Biophysics 2020Quote: ... except each nucleotide was present at a final concentration of 4 mM and the reaction was supplemented with 6 mM of 5’-biotin-G-Monophosphate (Trilink, #N-6003). Reactions were incubated at 37 °C for 2 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... IVT reactions performed as described for unmodified with 2 μl of the appropriate unmodified 75 mM NTP replaced by 5 μl of 10 mM Sp α-thiophosphate NTP (Biolog) or 2 μl 100 mM Rp/Sp α-thiophosphate NTP (TriLink).
-
bioRxiv - Bioengineering 2023Quote: ... synthesis of mRNA was carried out using MEGAscript™ T7 Transcription Kit (Waltham, MA, USA) with the addition of ACRA 5’ cap (Trilink biotechnologies) and m1Ψ-5’-triphosphate (Trilink biotechnologies ...
-
bioRxiv - Biochemistry 2020Quote: ... but with a dNTP mixture in which ATP and CTP were completely substituted with 2-amino-dATP and 5-propynyl-dCTP (TriLink Biotechnologies, San Diego, CA). Template DNA was then precipitated ...
-
bioRxiv - Cell Biology 2021Quote: ... 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N [methoxy (polyethyleneglycol)-2000] (DMPE-PEG2000, NOF Corporation) and contained CleanCap® Enhanced Green Fluorescent Protein (eGFP) mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7201) and/or Clean Cap®Cyanine5 (Cy5 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genes were targeted using two sgRNAs designed against regions at the 5’ end of each gene following the method outlined by Bassett et al.76 sgRNAs and Cas9 mRNA (TriLink Biotechnologies, San Diego, CA) were injected into D ...
-
bioRxiv - Biochemistry 2024Quote: ... The 3xFLAG-RLuc (humanized) and the 3xFLAG-HBB reporter both contain an AG initiator sequence for capping with the CleanCap reagent AG (TriLink Biotechnologies, Cat No. N-7113-5), the HBB 5’UTR and a short 3’UTR with a length of 20 bp and a BsmFI binding site downstream of the poly(A ...