Labshake search
Citations for TriLink BioTechnologies :
51 - 97 of 97 citations for Methacrylic acid N hydroxysuccinimide ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and replacing UTP with 1-methylpseudouridine triphosphate (N-1081, TriLink Biotechnologies) as previously described(14) ...
-
bioRxiv - Immunology 2022Quote: ... m7(3OMeG)(5⍰)ppp(5⍰)(2OMeA)pG (Cat: N-7113, TriLink), and of N1-methylpseudouridine-5’-triphosphate (Cat ...
-
bioRxiv - Immunology 2023Quote: ... The CleanCap Reagent AG (3′ OMe) (TriLink; cat. no. N-7413) was added to the in vitro transcription reaction mixture for co-transcriptional 5′-end capping ...
-
bioRxiv - Immunology 2023Quote: ... ψ-UTP (TriLink, San Diego, CA, USA; cat. no. N-1019) was used to substitute for UTP to prepare ψ-UTP-incorporated mRNA ...
-
bioRxiv - Genomics 2023Quote: ... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM of CleanCap Reagent AG (TriLink BioTech N-7113-100), and 5 mM of each NTP (Jena Bioscience NU-1010 ...
-
bioRxiv - Physiology 2021Quote: ... and CleanCap® Reagent AG (6 mM, N-7113, TriLink Biotechnologies, USA) (Zangi et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... UTP was replaced with either pseudouridine-5’-triphosphate (N-1019, TriLink Biotechnologies) or N1-Methylpseudouridine-5’-Triphosphate (N-1081 ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... fully substituting UTP with N1-methylpseudouridine-5’-triphosphate (TriLink Biotechnologies, N-1081) and co-transcriptionally capping with CleanCap Reagent AG (TriLink Biotechnologies ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... and co-transcriptionally capping with CleanCap Reagent AG (TriLink Biotechnologies, N-7114). IVT reactions were incubated at 37°C for 4 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... or CleanCap® Reagent AG (3’OMe) (CAT#: N-7413, TriLink Biotechnology) analog was added.
-
bioRxiv - Bioengineering 2024Quote: ... and co-transcriptionally capped with CleanCap AG (TriLink Biotechnologies, Cat #N-7113). Each IVT reaction contained 5 mM ATP ...
-
Effective targeting of CD19 positive primary B-ALL cells using CAR-NK cells generated with mRNA-LNPsbioRxiv - Cancer Biology 2024Quote: ... The mRNA was co-transcriptionally capped with CleanCap reagent (TriLink #N-7413) to enhance its stability and translation efficiency ...
-
bioRxiv - Microbiology 2021Quote: ... UTP was replaced with One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink, Cat# N-1081) for producing nucleoside-modified mRNAs ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.
-
bioRxiv - Microbiology 2024Quote: ... any remaining 3’-terminal ends were capped using ddGTP (2mM, TriLink BioTechnologies #N-4002). Excess unincorporated ddGTPs were removed by a DNA Clean & Concentrator kit (Zymo #11- 304C) ...
-
bioRxiv - Molecular Biology 2024Quote: ... an additional 10 mM of CleanCap® Reagent AU (CAT#: N-7114, TriLink Biotechnology) or CleanCap® Reagent AG (3’OMe ...
-
bioRxiv - Immunology 2024Quote: ... USA) with natural nucleosides and co-transcriptional capping with CleanCap AU (Trilink, N-7114). In vitro transcription of the Influenza HA saRNA construct derived from TC-83 was performed by Trilink (San Diego ...
-
bioRxiv - Biochemistry 2024Quote: ... mRNA was capped co-transcriptionally with CleanCap Reagent AG (TriLink BioTech N-7113-100). Each reaction contained final concentration of ∼50 µg/mL for linearized DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... GTP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) and synthesized in vitro as described in RNA preparation ...
-
bioRxiv - Biochemistry 2022Quote: ... The transcription reactions contained 0.5 mM of each NTPs and additional 4sUTP (TriLink N-1025) added in proportion to the number of Us in each transcript ...
-
bioRxiv - Immunology 2024Quote: ... 0.6mM dGTP and 0.2mM biotin-16-aminoallyl-2’-dUTP (TriLink BIoTechnologies, Cat No. N-5001). The reaction was first incubated at 95°C for 2 minutes and ramped down to 4°C at a rate of 0.1°C/s ...
-
bioRxiv - Immunology 2024Quote: ... USA) using 5-Methylcytosine (5mC) and co-transcriptional capping with CleanCap AU (Trilink, N-7114). N1-Methylpseudouridine-5’-Triphosphate-modified ...
-
bioRxiv - Genomics 2024Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Synthetic Biology 2023Quote: ... along with 500 ng of linear template and 4 mM CleanCap AG Reagent (Trilink, N-7113). 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink ...
-
bioRxiv - Systems Biology 2023Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Immunology 2023Quote: ... for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies, # N-7113-1). For large-scale mRNA production ...
-
bioRxiv - Molecular Biology 2024Quote: ... Capping was carried out co-transcriptionally using the CleanCap Reagent AG (3′ Ome) (N-7413, TriLink) and the Yeast Inorganic Pyrophosphatase (Cat ...
-
bioRxiv - Immunology 2024Quote: ... were carried out with natural nucleosides and co-transcriptional capping with CleanCap AU (Trilink, N-7114). RNA was purified with silica membrane spin columns (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... modified with full pseudo-UTP substitution using N1-Methyl-Pseudo-U (TriLink Biotechnologies, Cat #N-1081) and co-transcriptionally capped with CleanCap AG (TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... GTP or ATP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) or 7-deaza-ATP (TriLink ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... In vitro transcription was performed with complete substitution of uridine with N1-methylpseudouridine (Trilink Biotechnologies, N-1081). All transcripts were purified by silica-column chromatography followed by cellulose purification to remove dsRNA impurities.44 The presence of dsRNA impurities was determined by dot blot (500 ng/dot ...
-
bioRxiv - Immunology 2024Quote: ... consisting of 15-20 cycles with mutagenic nucleotides 8-oxo-dGTP and dPTP (TriLink O-0111, N-2037). The pCTCON2 system primers used were forward ...
-
bioRxiv - Genomics 2024Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Systems Biology 2023Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Microbiology 2021Quote: ... pseudouridine-substituted Fc-conjugated RBD mRNA (amino acids 331– 524; GenBank: QHD43416.1) was purchased from TriLink Bio Technologies (San Diego ...
-
bioRxiv - Biochemistry 2024Quote: ... For the 3xFLAG-RLuc and 3xFLAG-HBB reporter 0.8 mM CleanCap reagent AG (TriLink Biotechnologies, Cat No. N-7113-5) was included in the reaction ...
-
bioRxiv - Genomics 2022Quote: ... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
bioRxiv - Biochemistry 2024Quote: ... R2 protein mRNAs expressed C-terminally 3xFLAG tagged protein and were made with AG Clean cap (TriLink, catalog no. N-7113) per the manufacturer’s protocol using UTR sequences from the BioNTech COVID-19 vaccine mRNA (36 ...
-
bioRxiv - Biophysics 2020Quote: ... except each nucleotide was present at a final concentration of 4 mM and the reaction was supplemented with 6 mM of 5’-biotin-G-Monophosphate (Trilink, #N-6003). Reactions were incubated at 37 °C for 2 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... N1-methylpseudouridine substituted RNAs were produced by the complete replacement of uridine triphosphate in the T7 transcription reaction with N1-methylpseudouridine triphosphate (Trilink N-1081). Uridine and N1-methylpseudouridine RNAs were then mixed in equimolar ratios prior to in vitro translation.
-
bioRxiv - Cell Biology 2021Quote: ... 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N [methoxy (polyethyleneglycol)-2000] (DMPE-PEG2000, NOF Corporation) and contained CleanCap® Enhanced Green Fluorescent Protein (eGFP) mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7201) and/or Clean Cap®Cyanine5 (Cy5 ...
-
bioRxiv - Biochemistry 2024Quote: ... The 3xFLAG-RLuc (humanized) and the 3xFLAG-HBB reporter both contain an AG initiator sequence for capping with the CleanCap reagent AG (TriLink Biotechnologies, Cat No. N-7113-5), the HBB 5’UTR and a short 3’UTR with a length of 20 bp and a BsmFI binding site downstream of the poly(A ...