Labshake search
Citations for TriLink BioTechnologies :
51 - 100 of 102 citations for L Alanine N T Boc 13C3 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Synthetic mRNA encoding for full-length model antigen (i.e., CleanCap GFP, catalog L-7601 and CleanCap ovalbumin, OVA, catalog L-7610) were purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Physiology 2021Quote: ... and CleanCap® Reagent AG (6 mM, N-7113, TriLink Biotechnologies, USA) (Zangi et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... ATP was replaced by N6-Methyladenosine-5’-Triphosphate(m6ATP) (Trilink-N-1013;) for the IVT reaction of m6A-modified RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... UTP was replaced with either pseudouridine-5’-triphosphate (N-1019, TriLink Biotechnologies) or N1-Methylpseudouridine-5’-Triphosphate (N-1081 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.5 μg CleanCap Cas9 mRNA (TriLink, L-7206), 0.2 μg CleanCap mCherry mRNA (TrLink ...
-
bioRxiv - Cell Biology 2020Quote: ... ModRNA encoding GFP (TriLink, Cat No. L-7601) at a concentration of 0.2 μg per million h-MPCs served as negative control.
-
bioRxiv - Neuroscience 2022Quote: ... Cas9 mRNA (100 ng/uL. Trilink, L-6125) and both sgRNAs (100 ng/uL each ...
-
bioRxiv - Microbiology 2021Quote: ... UTP was replaced with One-methylpseudouridine (m1Ψ)-5’-triphosphate (TriLink, Cat# N-1081) for producing nucleoside-modified mRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Neuroscience 2019Quote: ... A synthetic CleanCap™ EGFP mRNA (TriLink, L-7201) was used as a transfection positive control in this study.
-
bioRxiv - Microbiology 2021Quote: Empty LNPs (eLNPs) and luciferase mRNA (TriLink, #L-7202)-loaded LNPs (LNP-Luc mRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng CleanCap Cas9 (5moU) mRNA (Trilink, L-7206) was electroporated into the cells using the Neon™ Transfection System (ThermoFisher) ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.
-
bioRxiv - Molecular Biology 2021Quote: ... GTP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) and synthesized in vitro as described in RNA preparation ...
-
bioRxiv - Biochemistry 2022Quote: ... The transcription reactions contained 0.5 mM of each NTPs and additional 4sUTP (TriLink N-1025) added in proportion to the number of Us in each transcript ...
-
bioRxiv - Synthetic Biology 2023Quote: ... along with 500 ng of linear template and 4 mM CleanCap AG Reagent (Trilink, N-7113). 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink ...
-
bioRxiv - Systems Biology 2023Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Immunology 2023Quote: ... for UTP and co-transcriptional capping with CleanCap® Reagent AG (TriLink Biotechnologies, # N-7113-1). For large-scale mRNA production ...
-
bioRxiv - Genomics 2024Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Neuroscience 2020Quote: ... Commercial Cas9 mRNA was ordered from TriLink (L-6125, San Diego, CA) and used for the embryo microinjection ...
-
bioRxiv - Immunology 2023Quote: ... transduced TIL5746 were electroporated with Cas9 mRNA (Trilink #L-7206, lot# T1COL01A) using an Amaxa 4D-Nucleofector unit and pulse code CA137 with Buffer P3 according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of Cas9 mRNA (50 ng/ µl, #L-6125, TriLink Biotechnologies) and two specific gRNAs (25 ng/ µl each ...
-
bioRxiv - Molecular Biology 2021Quote: ... GTP or ATP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) or 7-deaza-ATP (TriLink ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Neuroscience 2023Quote: ... RNP complexes were supplemented with 500 ng EGFP mRNA (Trilink Biotechnologies, L-7201) per well ...
-
bioRxiv - Immunology 2019Quote: ... ODN 5’ TCG TCG TCG TTC GAA CGA CGT TGA T 3’ as the sodium salt on a phosphorothioate backbone (ODN M362) was purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Immunology 2021Quote: ... ODN 5’ TCG TCG TCG TTC GAA CGA CGT TGA T 3’ as the sodium salt on a phosphorothioate backbone (ODN M362) was purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Systems Biology 2023Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Genomics 2024Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
bioRxiv - Genetics 2020Quote: ... 2E5 cells were transfected with 500ng of GFP mRNA (TriLink Biotechnologies, cat# L-7201) or RNP using a 96-well Shuttle nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries were prepared using the CleanTag Small RNA Library Preparation Kit (TriLink, L-3206) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Cas9 was then introduced using nucleofection of CleanCap 5moU Cas9 mRNA (Trilink, #L-7206). For base-editing experiments ...
-
bioRxiv - Molecular Biology 2021Quote: ... The lipid mixture was obtained with 25 mM sodium acetate buffer (pH 3; T&I, Gangwon-do, Korea) containing Renilla luciferase mRNA (TriLink, CA, USA) at a N/P ratio of 5.6 ...
-
bioRxiv - Genomics 2022Quote: ... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
bioRxiv - Genetics 2021Quote: ... both sgRNAs (20 ng/µl each) and Cas9 mRNA (50 ng/µl, TriLink Biotechnologies, L-7206) were injected into the pronucleus and cytoplasm of fertilized eggs (Transgenic Animal Modeling Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 30 pg - 1 ng of eGFP spike-in RNA (TriLink Biotechnologies L-7601-100), vortexed ...
-
bioRxiv - Immunology 2023Quote: ... were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Firefly luciferase mRNA (Cat. No. L-7702-1000) was obtained from Trilink Biotechnologies (San Diego ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated with the CleanCap® EGFP mRNA (#L-7601-100; TriLink Biotechnologies, San Diego, CA, USA) for the indicated times ...
-
bioRxiv - Biophysics 2020Quote: ... except each nucleotide was present at a final concentration of 4 mM and the reaction was supplemented with 6 mM of 5’-biotin-G-Monophosphate (Trilink, #N-6003). Reactions were incubated at 37 °C for 2 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... N1-methylpseudouridine substituted RNAs were produced by the complete replacement of uridine triphosphate in the T7 transcription reaction with N1-methylpseudouridine triphosphate (Trilink N-1081). Uridine and N1-methylpseudouridine RNAs were then mixed in equimolar ratios prior to in vitro translation.
-
bioRxiv - Immunology 2023Quote: ... a spike-in mRNA standard was added at this step (CleanCap EGFP mRNA from TriLink, L-7601) to account for RNA loss during processing ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the wget command (http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_38/gencode.v38.transcripts.fa.gz) and the sequence for the eGFP spike-in (TriLink L-7601) was manually appended to the reference transcriptome (https://www.trilinkbiotech.com/media/folio3/productattachments/product_insert/egfporf_catno_l-7201_l-7601_l-7701_.txt).
-
bioRxiv - Cell Biology 2021Quote: ... and/or Clean Cap®Cyanine5 (Cy5) Enhanced Green Fluorescent Protein mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7701).
-
bioRxiv - Microbiology 2020Quote: ... rRNA depleted samples were prepared for sequencing using the Cleantag Small RNA library prep kit (Trilink, L-3206-24) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... each sample was mixed in a 1.5mL tube with the appropriate volume of EGFP mRNA (996 nucleotides translated into a 26.9 kDa protein, 1 mg mL−1 L-7601, TriLink BioTechnologies) at final concentrations ranging from 10 μg mL−1 to 160 μg mL−1 (30 nM to 473 nM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences (20 ng/μL) and its corresponding donor oligonucleotide (100 ng/μL) were co-microinjected with Cas9 nickase mRNA (50 ng/μL, Trilink Biotechnologies) into the cytoplasm of zygotes collected from B6D2F1/J mice (JAX #100006) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions testing IRES nLuc reporters were additionally supplemented with 50 ng/µL (final) competitor FFLuc mRNA (TriLink Biotechnologies # L-7602-100) to increase the fidelity of the IRES nLuc signal ...
-
bioRxiv - Molecular Biology 2020Quote: ... each parental line was transfected with 1 µL of 100 µM sgRNA (Synthego Corporation) and 1 µg Cas9 mRNA (TriLink #L-7206) using the Neon Transfection System following standard protocols ...