Labshake search
Citations for Biosearch Technologies :
1 - 50 of 55 citations for Transcription Factor SOX 10 SOX10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA strands were individually transcribed in vitro using the AmpliScribe T7-Flash transcription (ASF3507, Biosearch Technologies) kit from DNA templates ...
-
bioRxiv - Biophysics 2020Quote: ... BHQ-10 maleimide was prepared from BHQ-10 succinimidyl ester (Biosearch Technologies) as described for the related BHQ-3 molecule (36) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the RNA strands were transcribed in vitro at 37°C using 7.5% (v/v) T7 polymerase from the AmpliScribe T7-Flash transcription kit (ASF3507, Biosearch Technologies), 40mM of Tris-HCl ...
-
bioRxiv - Genomics 2021Quote: Hybridization mix (200 nM probes in Stellaris hybridization buffer, Biosearch Technologies Cat# SMF-HB1-10 and 10% Formamide) was added after aspirating the wash buffer A and the sample was incubated upside-down facing the buffer at 37°C in the dark for about 18–24 h (within assembled humidified chamber) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to BHQ-10 succinimidyl ester (Biosearch Technologies). In a typical reaction ...
-
bioRxiv - Immunology 2023Quote: Mice were immunized by subcutaneous injection into the hind footpad of 10 μg OVA or 10 μg NP-OVA (Biosearch Technologies) adsorbed in alum (Imject Alum ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted in Hybridization Buffer (Biosearch Technologies SMF-HB1-10) plus 10% Deionized Formamide (Millipore 4610) ...
-
bioRxiv - Developmental Biology 2021Quote: ... before adding 200μl hybridization buffer (Biosearch Technologies, SMF-HB1-10) containing the U1 probe and covering the tissue with a glass coverslip ...
-
bioRxiv - Cell Biology 2022Quote: ... Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), Stellaris RNA FISH Wash Buffer A (Biosearch Technologies ...
-
bioRxiv - Immunology 2021Quote: ... or intravenously with 50 μg NP-Ficoll (Biosearch Technologies; F-1420-10). For influenza infections ...
-
bioRxiv - Immunology 2022Quote: ... were coated with NP3-BSA or NP14-BSA (10 mg/ml, Biosearch Technologies) in carbonate buffer (0.1 M NaHCO3 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 10 μg NP(19)-OVA (NP-OVA, Biosearch Technologies) absorbed in alum or 25 μg NP-OVA ...
-
bioRxiv - Immunology 2022Quote: ... chimeric mice were immunized intravenously with 10 μg/ml NP-Ficoll (Biosearch Technologies) in 100 μl PBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated with 50 µl Hybridization Buffer (LGC Biosearch Tech, Cat# SMF-HB1-10) containing RNA probe set overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then proceeded for hybridization with 100ul hybridization buffer (Biosearch Technologies, Cat# SMFHB1-10) containing Hmrhl probe (working concentration 125 nM ...
-
bioRxiv - Immunology 2019Quote: ... Plates were coated with 10 μg/mL NP31-bovine serum albumin (BSA, Biosearch Technologies) and blocked with PBS 3 % BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Permeabilized cells were then resuspended in 100 μL hybridisation solution (Biosearch Technologies, SMF-HB1-10) containing 1-3x of standard probe concentrations for WHI5 and MDN1 probes ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were hybridized with 80 μl of hybridization buffer (LGC Biosearch Technologies, SMF-HB1-10) supplemented with 10% deionized formamide containing the FISH probes at a 1:100 dilution at 37°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were incubated in Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10) with 10% deionized formamide and 125 µM Quasar 640-labeled oligonucleotide probes ...
-
bioRxiv - Microbiology 2021Quote: ... cells were then incubated with S4 probes diluted in Hybridization buffer (Biosearch Technologies, SMF-HB1-10) in a humidified chamber at 37°C for 4 h in the dark ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Cell Biology 2019Quote: ... 2ul of stellaris probes were diluted in 100ul of Stellaris hybridization buffer (Biosearch technologies SMF-HB1-10). Samples were hybridized overnight at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated in Hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10) and 10% Deionized Formamide ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Dll4 mRNA and Notch1 mRNA probes were mixed with the hybridization buffer (cat. # SMF-HB1-10, Biosearch technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with 10% v/v formamide in Stellaris® RNA FISH wash buffer A (Biosearch Technologies) and incubated in 1 mL of DAPI staining solution (5 ng/mL DAPI in wash buffer A with 10% v/v formamide ...
-
bioRxiv - Immunology 2023Quote: ... Half-area flat-bottom plates were coated with 10 µg/mL of NP2 or NP25 -BSA (Biosearch Technologies) or 5 µg/mL of goat anti-mouse IgG/IgM (Southern Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100μl of hybridization probe (100mg/ml dextran sulfate, 10% formamide, 2X SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) was added to the coverslips and incubated for 48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 10 minutes again and subjected to FISH staining using buffers from Biosearch Technologies as previously described [33] ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Microbiology 2019Quote: ... in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer, SMF-HB1-10, Biosearch Technologies, supplemented with 10% v/v of deionized formamide) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed twice with 10% deionized formamide in 2X SSC for 30 min at 37°C and once with Wash B (Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then washed with smFISH wash buffer (10% v/v formamide, 2X SSC in DPBS) and hybridized with smFISH probes (Biosearch Technologies) in hybridization buffer (0.1 g/mL dextran sulfate ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Genomics 2022Quote: ... The coverslips with cells were immersed in 100µl hybridization buffer (90µl Stellaris RNA-FISH Hybridization Buffer (Biosearch Technologies, Cat. SMF-HB1-10) and 10µl deionized formamide (Millipore Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... each cover glass was set on a droplet (cells facing down) consisting of 45 μL hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 1 μL of the duplex smiFISH probes (MS2-transcript-binding probe mix + FLAP-Y-binding region annealed to FLAP-Y-Cy5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Hybridization followed the manufacturer’s instructions (http://www.biosearchtech.com/stellarisprotocols) and was performed at 37°C for 16h in Stellaris RNA FISH hybridization buffer (Biosearch Technologies Cat# SMF-HB1-10) containing unc-8 probe at 1:100 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 ug of total RNA from cultured keratinocytes or fibroblasts was treated without (control) or with 10 units of RNase R in 10X RNase R reaction buffer (LGC Biosearch Technologies, Hoddesdon, UK). Treatment was conducted at 37°C for 12 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were incubated with 125 nM of each probeset (one for histone genes and second one for a control gene FOS in the Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies; SMF-HB1-10) overnight at 37°C in humified chamber ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mL deionized formamide) followed by 100 μL of freshly prepared Hybridization Buffer (90 μL Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), 10 μL deionized formamide ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Immunology 2023Quote: ... The titers of NP-specific antibody isotypes in sera were measured by ELISA using plates coated with NP(7)- BSA or NP(20)-BSA (Biosearch Technologies) as described previously (63).
-
bioRxiv - Microbiology 2020Quote: ... Ethanol 70% is discarded and cells washed with 200 μL wash buffer A (10% vol./vol. formamide in 1X Wash Buffer A, Biosearch Technologies Cat# SMF-WA1-60). Cells were incubated with 100 μL Hybridization buffer containing 1,25 μM of RNA-FISH probes in the dark at 37 °C overnight (~16 hours) ...