Labshake search
Citations for Biosearch Technologies :
1 - 50 of 106 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Immunology 2023Quote: ... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was circularized by CircLigase I (LGC Biosearch Technologies) and amplified with 25 PCR cycles by Phusion High-Fidelity DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... treated with 20 U of RNase I (LGC Biosearch Technologies) (i.e. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosome footprint was generated using 15 U RNase I (Biosearch Technologies, N6901K) to 300 ug RNA in 200 μL reaction volume at room temperature for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: The lysate was treated with 20 U of RNase I (LGC Biosearch Technologies) at 25°C for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was incubated with 40 U of RNase I (LGC Biosearch Technologies) in a 50 µl reaction (brought up to volume with the modified lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing Stellaris RNA FISH probes (Biosearch Technologies) at a final concentration of 125 nM (Supplementary File 6 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing Stellaris RNA FISH probes (Biosearch Technologies) at a final concentration of 125 nM (Supplementary Table 7 ...
-
bioRxiv - Molecular Biology 2023Quote: The lysate was incubated with 2 U of RNase I (LGC Biosearch Technologies, low), 10 U of RNase I (high) ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Immunology 2023Quote: ... The titers of NP-specific antibody isotypes in sera were measured by ELISA using plates coated with NP(7)- BSA or NP(20)-BSA (Biosearch Technologies) as described previously (63).
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with 100 μg 4-hydroxy-3-nitrophenyl acetyl (NP)-CGG (Biosearch Technologies) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were further washed in Wash Buffer I (20% Stellaris RNA FISH Wash Buffer A (Biosearch Technologies, Inc., SMF-WA1-60), 10% Deionized Formamide (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then incubated overnight at 37C in hybridization buffer containing smFISH probes (Biosearch Technologies) diluted 1:50 ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Immunology 2023Quote: ... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were injected intraperitoneally with 50μg of 4-hydroxy-3-nitrophenylacetyl (NP)-CGG (BioSearch Technologies) in PBS ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...
-
bioRxiv - Immunology 2019Quote: Mice were immunized intra-peritoneally with 25 μg of 4-hydroxy-3-nitrophenylaceyl-lipopolysaccharide (NP-LPS) (Biosearch Technologies). Blood ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100µg of 4-Hydroxy-3-nitrophenylacetyl hapten-17 (NP17)-OVA (Biosearch Technologies, 1µg/mL) mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100μl of hybridization probe (100mg/ml dextran sulfate, 10% formamide, 2X SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) was added to the coverslips and incubated for 48 hours ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Cell Biology 2019Quote: ... containing Dapi for 30 minutes at 37°C and then once with Stellaris wash buffer A (Biosearch technologies SMF-WA1-60) containing 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated with the pre-hybridization buffer containing ACTB probes labelled with Quasar 670 dye (Stellaris RNA FISH probes, Biosearch Technologies) at a final concentration of 500 nM for 20 hours at 37°C to label β-actin mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleofected clones were isolated by limiting dilution and indel-containing clonal populations were screened by extracting gDNA using Quick Extract (Biosearch Technologies) for PCR amplification using primers targeting up and downstream the Cas9 cut-site ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...