Labshake search
Citations for Biosearch Technologies :
1 - 50 of 114 citations for Mono 2 Ethyl 5 Carboxypentyl Phthalate 90% Pure 13C4 99% Dehp Metabolite V ;100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 100ug of NP(24)-CGG (Cat. N5055C-5, Biosearch technologies) emulsified in alum (Cat ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mL deionized formamide) followed by 100 μL of freshly prepared Hybridization Buffer (90 μL Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2023Quote: mRNA was isolated using Master Pure Complete DNA&RNA purification kit (Biosearch technologies) according to the manufacturer’s instructions except that scale was increased 2 times ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were subsequently submerged in wash buffer A (10% [v/v] de-ionised formamide, 20% [v/v] Stellaris wash buffer A [LGC Biosearch Technologies, Cat. No. SMF-WA1-60], 70% H2O) for 10–15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were washed with 2 mL of wash buffer A (LGC Biosearch Technologies) supplemented with 10% deionized formamide (Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were then washed with 2 mL of Wash buffer A (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with 10% v/v formamide in Stellaris® RNA FISH wash buffer A (Biosearch Technologies) and incubated in 1 mL of DAPI staining solution (5 ng/mL DAPI in wash buffer A with 10% v/v formamide ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated in Hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10) and 10% Deionized Formamide ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pure lactobacilli isolates had their DNA extracted using MasterPure™ Gram Positive Purification Kit (LGC Biosearch Technologies, Hoddesdon, UK). All DNA extraction quantifications were performed with Qubit Fluorometer (Thermo Fischer Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the RNA strands were transcribed in vitro at 37°C using 7.5% (v/v) T7 polymerase from the AmpliScribe T7-Flash transcription kit (ASF3507, Biosearch Technologies), 40mM of Tris-HCl ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then washed with smFISH wash buffer (10% v/v formamide, 2X SSC in DPBS) and hybridized with smFISH probes (Biosearch Technologies) in hybridization buffer (0.1 g/mL dextran sulfate ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated in a humidified chamber at 37 °C for 14 hours with probes diluted in Stellaris RNA FISH Hybridisation Buffer (LGC Biosearch Technologies; with 10% (v/v) formamide added ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2022Quote: ... while TNP-BSA (load 5; LGC BioSearch Technologies) was used for the identification of TNP-specific antibody-secreting cells ...
-
bioRxiv - Genomics 2022Quote: ... 100μg NP-KLH (Biosearch Technologies, N-5060-5) plus 1μg LPS (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Cell Biology 2024Quote: ... DesignReady Stellaris® probe sets against mCherry (labelled with Quasar®-670, # VSMF-1031-5) and GFP (labelled with Quasar®-570, # VSMF-1014-5) from Biosearch Technologies were used.
-
bioRxiv - Immunology 2019Quote: ... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) was mixed with Alum (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) in PBS was mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylcholine Keyhole Limpet Hemocyanin (PC-KLH, LGC Biosearch Technologies, Cat# PC-1013-5) was applied at a concentration of 100 ng per well ...
-
bioRxiv - Immunology 2019Quote: ... at 10µg/ml or NP20-BSA (Biosearch Technologies) at 2.5µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 ng/ml NIP-15-BSA (Biosearch Technologies) was added to the media bath and images were collected after a short incubation of about 5 min and proceeded for about 30 min ...
-
bioRxiv - Genomics 2023Quote: ... Next the samples were transformed into electrocompetent cells (Biosearch Technologies, 60242-2). One 0.1cm cuvette (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... we resuspended the pellet from each sample in 750 mL of chilled resuspension buffer (1X PBS, 0.4 mg/mL BSA, 0.2 U/μL RNAse Inhibitor [Biosearch Technologies, Cat. 30281]) containing one of 8 unique XPoSE-tags (Nucleoporin 62 antibody conjugated to R718 fluorescent dye and one of eight distinct oligo-based Sample Tags (ST ...
-
bioRxiv - Genomics 2020Quote: ... coverslips were incubated for 5 minutes in Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), followed by hybridization overnight at 37°C with 250 nM of each FISH probe in 50 μl Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Microbiology 2023Quote: ... 100 U/mL Omnicleave (Biosearch Technologies, Novato, CA, USA), Roche protease inhibitor cOmplete tablets EDTA free ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Immunology 2021Quote: ... Staining was performed with 1 µM Cal Fluor 610 conjugated pals-5 smFISH probes (Biosearch Technologies) in smFISH hybridization buffer (10% formamide ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...