Labshake search
Citations for Biosearch Technologies :
151 - 200 of 231 citations for 9 10 Dihydro 4H benzo 4 5 cyclohepta 1 2 b thiophen 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Cell Biology 2019Quote: ... 2ul of stellaris probes were diluted in 100ul of Stellaris hybridization buffer (Biosearch technologies SMF-HB1-10). Samples were hybridized overnight at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated in Hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10) and 10% Deionized Formamide ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... Dll4 mRNA and Notch1 mRNA probes were mixed with the hybridization buffer (cat. # SMF-HB1-10, Biosearch technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with 10% v/v formamide in Stellaris® RNA FISH wash buffer A (Biosearch Technologies) and incubated in 1 mL of DAPI staining solution (5 ng/mL DAPI in wash buffer A with 10% v/v formamide ...
-
bioRxiv - Immunology 2023Quote: ... Half-area flat-bottom plates were coated with 10 µg/mL of NP2 or NP25 -BSA (Biosearch Technologies) or 5 µg/mL of goat anti-mouse IgG/IgM (Southern Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100μl of hybridization probe (100mg/ml dextran sulfate, 10% formamide, 2X SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) was added to the coverslips and incubated for 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 10 minutes again and subjected to FISH staining using buffers from Biosearch Technologies as previously described [33] ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Microbiology 2019Quote: ... in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer, SMF-HB1-10, Biosearch Technologies, supplemented with 10% v/v of deionized formamide) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then washed with smFISH wash buffer (10% v/v formamide, 2X SSC in DPBS) and hybridized with smFISH probes (Biosearch Technologies) in hybridization buffer (0.1 g/mL dextran sulfate ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The coverslips with cells were immersed in 100µl hybridization buffer (90µl Stellaris RNA-FISH Hybridization Buffer (Biosearch Technologies, Cat. SMF-HB1-10) and 10µl deionized formamide (Millipore Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... each cover glass was set on a droplet (cells facing down) consisting of 45 μL hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 1 μL of the duplex smiFISH probes (MS2-transcript-binding probe mix + FLAP-Y-binding region annealed to FLAP-Y-Cy5 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Hybridization followed the manufacturer’s instructions (http://www.biosearchtech.com/stellarisprotocols) and was performed at 37°C for 16h in Stellaris RNA FISH hybridization buffer (Biosearch Technologies Cat# SMF-HB1-10) containing unc-8 probe at 1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 ug of total RNA from cultured keratinocytes or fibroblasts was treated without (control) or with 10 units of RNase R in 10X RNase R reaction buffer (LGC Biosearch Technologies, Hoddesdon, UK). Treatment was conducted at 37°C for 12 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...
-
bioRxiv - Cell Biology 2024Quote: GAPDH smFISH probe (Biosearch Technologies Inc.: SMF-2026-1). All other probes were generated using Stellaris probe design tool.
-
bioRxiv - Molecular Biology 2023Quote: Assay mixes were prepared in 16 μL volumes for each unique crRNA target consisting of 1 μL of 50 U/μL NxGen T7 Polymerase (Biosearch Technologies 30223-1), 2 μL of 800 nM LwaCas13a (Genscript) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mL deionized formamide) followed by 100 μL of freshly prepared Hybridization Buffer (90 μL Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), 10 μL deionized formamide ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a Stellaris FISH probe (Biosearch Technologies, SMF-2038-1), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... we used a Stellaris probe (Biosearch Technologies, SMF-2038-1) to detect XIST RNA ...
-
bioRxiv - Microbiology 2020Quote: ... Ethanol 70% is discarded and cells washed with 200 μL wash buffer A (10% vol./vol. formamide in 1X Wash Buffer A, Biosearch Technologies Cat# SMF-WA1-60). Cells were incubated with 100 μL Hybridization buffer containing 1,25 μM of RNA-FISH probes in the dark at 37 °C overnight (~16 hours) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated in a humidified chamber at 37 °C for 14 hours with probes diluted in Stellaris RNA FISH Hybridisation Buffer (LGC Biosearch Technologies; with 10% (v/v) formamide added ...