Labshake search
Citations for Biosearch Technologies :
51 - 100 of 109 citations for 8 Chloro pyrido 3 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... After washing with 1 mL of Stellaris® RNA FISH wash buffer B (Biosearch Technologies) cells were mounted in Vectashield® mounting medium (Vector Laboratories) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with 200 μL of wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) and incubated with it at room temperature for 2-5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... at 37°C and then once with Stellaris wash buffer B (Biosearch technologies SMF-WB1-20) for three minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... then in 1 mL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with Hoescht stain at 1:10,000 dilution for 5 min at RT ...
-
bioRxiv - Immunology 2023Quote: NP-specific memory B cells were identified by staining with biotinylated NIP(15)-BSA (Biosearch Technologies) at 330 ng/ml for 30 min on ice and then with streptavidin APC ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: smFISH was performed with custom unc-8 probes linked to Quasar® 670 (Biosearch Technologies). Synchronized larvae (from either late L1 or early L3 stage ...
-
bioRxiv - Genomics 2021Quote: ... DAPI solution was aspirated and samples were washed once with wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... and samples were subsequently incubated with Stellaris® RNA FISH Wash Buffer B (Biosearch Technologies; Cat #: SMF-WB1-20) as prepared through manufacturers protocol for 5 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Washes and hybridization were performed with Stellaris Buffers (WASH buffer A, WASH buffer B, Hybridization Buffer; LGC Biosearch Technologies), following the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each sample was then washed twice with Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with the second wash left to incubate for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... dishes were incubated with Wash Buffer A for 30 minutes at 37°C followed by addition and incubation of Wash Buffer B (LGC Biosearch Technologies) for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed twice with 10% deionized formamide in 2X SSC for 30 min at 37°C and once with Wash B (Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 FISH probes (IDT) (Table S3) marked with FAM were designed using the Stellaris probe designer software (Biosearch Technologies). Cells were grown either on Falcon® 8-well Culture Slide (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: ... and samples were subsequently washed with 500 uL of Stellaris® RNA FISH Wash Buffer B (Biosearch Technologies; Cat #: SMF-WB1-20) as prepared through manufacturers and incubated with 100 uL of Stellaris® RNA FISH Wash Buffer B protocol for 5 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Developmental Biology 2019Quote: ... ovaries were washed twice with Wash Buffer A at 37 °C for 30 minutes and once with Wash Buffer B (LGC Biosearch Tech, Cat# SMF-WB1-20) at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... A glr-4 probe was designed using the Stellaris Probe Designer website (Biosearch Technologies). The probe was mixed in hybridization buffer (0.1 g/ml dextran sulfate [Sigma D8906-50G] ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2022Quote: In vitro BCR stimulation with cognate antigen was performed by adding NP(4)BSA (Biosearch Technologies), NP(25)BSA (Biosearch Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with NP3– or NP14–bovine serum albumin (BSA; Biosearch Technologies), diluted in carbonate buffer ...
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA in situ hybridisation in adult ventral nerve cords for the precursor RNA transcripts of miR-iab-4 was performed by designing 48 unique 20nt-probes labelled with Quasar 570 in the Stellaris platform from Biosearch Technologies, and using an adapted version of the protocol by Raj A ...
-
bioRxiv - Immunology 2021Quote: ... for ELISPOT assays were prepared with 35% ethanol and then coated overnight at 4 °C with TNP-BSA or NP-BSA (Biosearch Technologies). Plates were washed and subsequently blocked at 37 °C with complete culture media prior to plating and culturing splenocytes or bone marrow cells for 18 h at 37 °C ...