Labshake search
Citations for Biosearch Technologies :
51 - 96 of 96 citations for 7 Bromo 4 chlorothieno 3 2 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The lysate was incubated with 2 U of RNase I (LGC Biosearch Technologies, low), 10 U of RNase I (high) ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 smFISH probes were designed using Stellaris smFISH probe designer (Biosearch Technologies) available online at http://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA in situ hybridisation in adult ventral nerve cords for the precursor RNA transcripts of miR-iab-4 was performed by designing 48 unique 20nt-probes labelled with Quasar 570 in the Stellaris platform from Biosearch Technologies, and using an adapted version of the protocol by Raj A ...
-
bioRxiv - Immunology 2021Quote: ... for ELISPOT assays were prepared with 35% ethanol and then coated overnight at 4 °C with TNP-BSA or NP-BSA (Biosearch Technologies). Plates were washed and subsequently blocked at 37 °C with complete culture media prior to plating and culturing splenocytes or bone marrow cells for 18 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then incubated in 70% ethanol at 4°C for at least 1 h and then washed with 1 ml of Wash Buffer A (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Molecular Biology 2023Quote: ... After fixation with 4% PFA cells were permeabilized by incubation in 70% EtOH for at least 1 hr at 4°C followed by incubation in Stellaris Wash Buffer A (Biosearch Tech) for 5 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Genomics 2023Quote: ... Cover glasses were incubated in 70% ethanol at 4°C for at least one hour and then washed with 1 mL of wash buffer A (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Genetics 2022Quote: ... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Systems Biology 2022Quote: ... incubated at 4°C for 1 h and then washed with 200 μl of wash buffer A (LGC Biosearch Technologies, SMF-WA1-60) supplemented with 10% deionized formamide (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Developmental Biology 2020Quote: ... Custom Stellaris FISH Probes were designed against target transcripts (Supplementary Table 4) by utilizing the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner (version 4.2) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...