Labshake search
Citations for Biosearch Technologies :
101 - 150 of 211 citations for 7 7 4 4 Bipiperidine 1 1 diyldi 2 1 ethanediyl bis 10 methoxy 7H pyrido 4 3 c carbazole tetramethanesulfonate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs and PBMCs were then run in a thermocycler for one round of three consecutive cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 70% ethanol was then removed and 1 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60) with 10% deionized formamide for 5 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The probes for the coronavirus assays (E/IP4) were both labelled with a FAM reporter and black hole quencher 1 (Biosearch Technologies) and the XIPC probe with a Vic reporter and TAMRA quencher (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: Xist RNA was detected with Stellaris® RNA FISH (Human XIST with Quasar® 570 Dye, Biosearch Technologies, SMF-2038-1) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Cell Biology 2022Quote: ... Oligonucleotides with 3’ amino group (LGC Biosearch Technologies) were pooled and coupled with either Cy®3 Mono NHS Ester (GE healthcare ...
-
bioRxiv - Genomics 2020Quote: We designed 48 Custom Stellaris FISH Probes against slow-1 mRNA using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2019Quote: ... Custom probes were designed against the exons of the eff-1 gene by utilizing the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). The probes were hybridized with the dye Cy5 (Huelsz-Prince and van Zon 2017) ...
-
bioRxiv - Genetics 2024Quote: Stellaris® FISH Probes recognizing either the coding region of eGFP mRNA or GAPDH mRNA labeled with Quasar® 670 Dye (VSMF-1015-5 for eGFP and SMF-2019-1 for GAPDH, from Biosearch Technologies, Inc., Petaluma, CA) were hybridized to HEK293T cell lines expressing integrated eGFP reporters with different length 3′UTRs according to manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... BHQ-10 maleimide was prepared from BHQ-10 succinimidyl ester (Biosearch Technologies) as described for the related BHQ-3 molecule (36) ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Genomics 2021Quote: Hybridization mix (200 nM probes in Stellaris hybridization buffer, Biosearch Technologies Cat# SMF-HB1-10 and 10% Formamide) was added after aspirating the wash buffer A and the sample was incubated upside-down facing the buffer at 37°C in the dark for about 18–24 h (within assembled humidified chamber) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to BHQ-10 succinimidyl ester (Biosearch Technologies). In a typical reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were immunized by subcutaneous injection into the hind footpad of 10 μg OVA or 10 μg NP-OVA (Biosearch Technologies) adsorbed in alum (Imject Alum ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted in Hybridization Buffer (Biosearch Technologies SMF-HB1-10) plus 10% Deionized Formamide (Millipore 4610) ...
-
bioRxiv - Cell Biology 2019Quote: ... at 37°C and then once with Stellaris wash buffer B (Biosearch technologies SMF-WB1-20) for three minutes at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... before adding 200μl hybridization buffer (Biosearch Technologies, SMF-HB1-10) containing the U1 probe and covering the tissue with a glass coverslip ...
-
bioRxiv - Cell Biology 2022Quote: ... Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), Stellaris RNA FISH Wash Buffer A (Biosearch Technologies ...
-
bioRxiv - Genomics 2023Quote: ... Next the samples were transformed into electrocompetent cells (Biosearch Technologies, 60242-2). One 0.1cm cuvette (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were washed with 2 mL of wash buffer A (LGC Biosearch Technologies) supplemented with 10% deionized formamide (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Coverslips were washed twice for 30 min at 37°C with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), with 0.2 mg/ml Dapi being added to the second wash ...
-
bioRxiv - Bioengineering 2023Quote: ... the MBP-C PNP and its variants were transformed into the lipopolysaccharide defective ClearColi BL21(DE3) strain (Biosearch Technologies), and induced by 1 mM IPTG for 16-20 hours at 20 °C ...
-
bioRxiv - Immunology 2021Quote: ... or intravenously with 50 μg NP-Ficoll (Biosearch Technologies; F-1420-10). For influenza infections ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were then washed with 2 mL of Wash buffer A (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: The lysate was incubated with 2 U of RNase I (LGC Biosearch Technologies, low), 10 U of RNase I (high) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the RNA strands were transcribed in vitro at 37°C using 7.5% (v/v) T7 polymerase from the AmpliScribe T7-Flash transcription kit (ASF3507, Biosearch Technologies), 40mM of Tris-HCl ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Immunology 2022Quote: ... were coated with NP3-BSA or NP14-BSA (10 mg/ml, Biosearch Technologies) in carbonate buffer (0.1 M NaHCO3 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 10 μg NP(19)-OVA (NP-OVA, Biosearch Technologies) absorbed in alum or 25 μg NP-OVA ...
-
bioRxiv - Immunology 2022Quote: ... chimeric mice were immunized intravenously with 10 μg/ml NP-Ficoll (Biosearch Technologies) in 100 μl PBS ...