Labshake search
Citations for Biosearch Technologies :
101 - 150 of 175 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Re-hydrated samples were hybridized with 62.5 nM of an equimolar mixture of Cy3-labelled DNA probes designed to target the coding region of the gene segment 6 of simian rotavirus A/SA11 (Genbank Acc. AY187029.1) using Stellaris Probe Designer v2 software (LCG Biosearch Technologies), in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... the glass coverslips were transferred to a fresh 6-well plate with the cell side up and incubated with Wash Buffer A (Biosearch Technologies) and Hoechst stain (1:2000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylcholine Keyhole Limpet Hemocyanin (PC-KLH, LGC Biosearch Technologies, Cat# PC-1013-5) was applied at a concentration of 100 ng per well ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 100ug of NP(24)-CGG (Cat. N5055C-5, Biosearch technologies) emulsified in alum (Cat ...
-
bioRxiv - Genomics 2020Quote: ... coverslips were incubated for 5 minutes in Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), followed by hybridization overnight at 37°C with 250 nM of each FISH probe in 50 μl Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then incubated in 70% ethanol at 4°C for at least 1 h and then washed with 1 ml of Wash Buffer A (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...
-
bioRxiv - Cell Biology 2024Quote: GAPDH smFISH probe (Biosearch Technologies Inc.: SMF-2026-1). All other probes were generated using Stellaris probe design tool.
-
bioRxiv - Molecular Biology 2023Quote: Assay mixes were prepared in 16 μL volumes for each unique crRNA target consisting of 1 μL of 50 U/μL NxGen T7 Polymerase (Biosearch Technologies 30223-1), 2 μL of 800 nM LwaCas13a (Genscript) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a Stellaris FISH probe (Biosearch Technologies, SMF-2038-1), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... we used a Stellaris probe (Biosearch Technologies, SMF-2038-1) to detect XIST RNA ...
-
bioRxiv - Immunology 2021Quote: ... or 100 ug NP-CGG (conjugation ratio 20-29:1) (Biosearch Technologies) in Imject Alum (Thermofisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... After electroporation transformation with Endura Electrocompetent Cells (60242-1, Biosearch Technologies, USA), the cells were plated into Nunc™ Square BioAssay Dishes (Catalog number ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... lag-1 Stellaris smFISH probes were designed by and obtained from Biosearch Technologies. The fixed dissected gonads were incubated with probe at final concentration of 5 µM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Single-molecule FISH probes except for the POLR2A (SMF-2006-1, Biosearch Technologies) and firefly luciferase mRNA single-molecule FISH probes (Matheny et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cleaned assembly reactions were electroporated into Endura Electrocompetent cells (Biosearch Technologies 60242-1) according to manufacturer’s instructions and plated on LB-Lennox 250 mm x 250 mm square bioassay dishes supplemented with 75 µg/mL carbenicillin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and erm-1 mRNAs using the Stellaris FISH Probe Designer (Biosearch Technologies, Petaluma, CA). Probes against other mRNAs were designed following the smiFISH approach as previously described (Tsanov et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 29 probes for kni) were designed (Supplementary Table 1) and synthesized (Biosearch Technologies). Each probe was ordered with a 3’ amine group (mdC(TEG-Amino) ...
-
bioRxiv - Immunology 2020Quote: ... NP25-PE or NP23-PE was used at 1:200 dilution (LGC Biosearch Technologies).
-
bioRxiv - Immunology 2020Quote: ... NP(1-9)-BSA or NP(>20)-BSA (N-5050L, N-5050H, Biosearch Technologies) at 50 μg/mL in 25 μL PBS ...