Labshake search
Citations for Biosearch Technologies :
151 - 200 of 211 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...
-
bioRxiv - Cell Biology 2024Quote: GAPDH smFISH probe (Biosearch Technologies Inc.: SMF-2026-1). All other probes were generated using Stellaris probe design tool.
-
bioRxiv - Molecular Biology 2023Quote: Assay mixes were prepared in 16 μL volumes for each unique crRNA target consisting of 1 μL of 50 U/μL NxGen T7 Polymerase (Biosearch Technologies 30223-1), 2 μL of 800 nM LwaCas13a (Genscript) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a Stellaris FISH probe (Biosearch Technologies, SMF-2038-1), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... we used a Stellaris probe (Biosearch Technologies, SMF-2038-1) to detect XIST RNA ...
-
bioRxiv - Immunology 2021Quote: ... or 100 ug NP-CGG (conjugation ratio 20-29:1) (Biosearch Technologies) in Imject Alum (Thermofisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... After electroporation transformation with Endura Electrocompetent Cells (60242-1, Biosearch Technologies, USA), the cells were plated into Nunc™ Square BioAssay Dishes (Catalog number ...
-
bioRxiv - Developmental Biology 2020Quote: ... lag-1 Stellaris smFISH probes were designed by and obtained from Biosearch Technologies. The fixed dissected gonads were incubated with probe at final concentration of 5 µM ...
-
bioRxiv - Molecular Biology 2021Quote: Single-molecule FISH probes except for the POLR2A (SMF-2006-1, Biosearch Technologies) and firefly luciferase mRNA single-molecule FISH probes (Matheny et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cleaned assembly reactions were electroporated into Endura Electrocompetent cells (Biosearch Technologies 60242-1) according to manufacturer’s instructions and plated on LB-Lennox 250 mm x 250 mm square bioassay dishes supplemented with 75 µg/mL carbenicillin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and erm-1 mRNAs using the Stellaris FISH Probe Designer (Biosearch Technologies, Petaluma, CA). Probes against other mRNAs were designed following the smiFISH approach as previously described (Tsanov et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 29 probes for kni) were designed (Supplementary Table 1) and synthesized (Biosearch Technologies). Each probe was ordered with a 3’ amine group (mdC(TEG-Amino) ...
-
bioRxiv - Immunology 2020Quote: ... NP25-PE or NP23-PE was used at 1:200 dilution (LGC Biosearch Technologies).
-
bioRxiv - Immunology 2020Quote: ... NP(1-9)-BSA or NP(>20)-BSA (N-5050L, N-5050H, Biosearch Technologies) at 50 μg/mL in 25 μL PBS ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of Hybridase Thermostable RNase H at 45°C (Lucigen (now Biosearch Technologies), Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ninety-six-well plates were coated with 1 μg/ml NP-BSA (Biosearch Technologies) in bicarbonate buffer ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed with 1 ml of Wash buffer A (Biosearch Technologies, SMF-WA1-60). To probe for S4 mRNA ...
-
bioRxiv - Immunology 2021Quote: ... with 50 ug NP-Ficoll (conjugation ratio 55:1) in 100 uL saline (Biosearch Technologies) or 100 ug NP-CGG (conjugation ratio 20-29:1 ...
-
bioRxiv - Microbiology 2023Quote: ... the buffer was supplemented with 1 U/µl of an RNase inhibitor (302811, LGC Biosearch Technologies).
-
bioRxiv - Genetics 2023Quote: ... and then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs were then run in a thermocycler for three consecutive cycles ...