Labshake search
Citations for Biosearch Technologies :
101 - 136 of 136 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and then proceeded for hybridization with 100ul hybridization buffer (Biosearch Technologies, Cat# SMFHB1-10) containing Hmrhl probe (working concentration 125 nM ...
-
bioRxiv - Immunology 2019Quote: ... Plates were coated with 10 μg/mL NP31-bovine serum albumin (BSA, Biosearch Technologies) and blocked with PBS 3 % BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Permeabilized cells were then resuspended in 100 μL hybridisation solution (Biosearch Technologies, SMF-HB1-10) containing 1-3x of standard probe concentrations for WHI5 and MDN1 probes ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were hybridized with 80 μl of hybridization buffer (LGC Biosearch Technologies, SMF-HB1-10) supplemented with 10% deionized formamide containing the FISH probes at a 1:100 dilution at 37°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were incubated in Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10) with 10% deionized formamide and 125 µM Quasar 640-labeled oligonucleotide probes ...
-
bioRxiv - Microbiology 2021Quote: ... cells were then incubated with S4 probes diluted in Hybridization buffer (Biosearch Technologies, SMF-HB1-10) in a humidified chamber at 37°C for 4 h in the dark ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Cell Biology 2019Quote: ... 2ul of stellaris probes were diluted in 100ul of Stellaris hybridization buffer (Biosearch technologies SMF-HB1-10). Samples were hybridized overnight at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated in Hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10) and 10% Deionized Formamide ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Dll4 mRNA and Notch1 mRNA probes were mixed with the hybridization buffer (cat. # SMF-HB1-10, Biosearch technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with 10% v/v formamide in Stellaris® RNA FISH wash buffer A (Biosearch Technologies) and incubated in 1 mL of DAPI staining solution (5 ng/mL DAPI in wash buffer A with 10% v/v formamide ...
-
bioRxiv - Immunology 2023Quote: ... Half-area flat-bottom plates were coated with 10 µg/mL of NP2 or NP25 -BSA (Biosearch Technologies) or 5 µg/mL of goat anti-mouse IgG/IgM (Southern Biotech ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100μl of hybridization probe (100mg/ml dextran sulfate, 10% formamide, 2X SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) was added to the coverslips and incubated for 48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with 110 µL Hybridization Buffer [99 µL Stellaris RNA FISH Hybridization Buffer (LGC Biosearch Technologies, SMF-HB1-10), 11 µL deionized formamide] containing 1.1 µL 12.5 µM vgRNA FISH probes for 4 hours at 37°C in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were fixed with 3.7% formaldehyde in PBS for 10 minutes again and subjected to FISH staining using buffers from Biosearch Technologies as previously described [33] ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Microbiology 2019Quote: ... in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer, SMF-HB1-10, Biosearch Technologies, supplemented with 10% v/v of deionized formamide) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed twice with 10% deionized formamide in 2X SSC for 30 min at 37°C and once with Wash B (Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then washed with smFISH wash buffer (10% v/v formamide, 2X SSC in DPBS) and hybridized with smFISH probes (Biosearch Technologies) in hybridization buffer (0.1 g/mL dextran sulfate ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Genomics 2022Quote: ... The coverslips with cells were immersed in 100µl hybridization buffer (90µl Stellaris RNA-FISH Hybridization Buffer (Biosearch Technologies, Cat. SMF-HB1-10) and 10µl deionized formamide (Millipore Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... each cover glass was set on a droplet (cells facing down) consisting of 45 μL hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 1 μL of the duplex smiFISH probes (MS2-transcript-binding probe mix + FLAP-Y-binding region annealed to FLAP-Y-Cy5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Hybridization followed the manufacturer’s instructions (http://www.biosearchtech.com/stellarisprotocols) and was performed at 37°C for 16h in Stellaris RNA FISH hybridization buffer (Biosearch Technologies Cat# SMF-HB1-10) containing unc-8 probe at 1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 ug of total RNA from cultured keratinocytes or fibroblasts was treated without (control) or with 10 units of RNase R in 10X RNase R reaction buffer (LGC Biosearch Technologies, Hoddesdon, UK). Treatment was conducted at 37°C for 12 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were incubated with 125 nM of each probeset (one for histone genes and second one for a control gene FOS in the Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies; SMF-HB1-10) overnight at 37°C in humified chamber ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mL deionized formamide) followed by 100 μL of freshly prepared Hybridization Buffer (90 μL Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), 10 μL deionized formamide ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Microbiology 2020Quote: ... Ethanol 70% is discarded and cells washed with 200 μL wash buffer A (10% vol./vol. formamide in 1X Wash Buffer A, Biosearch Technologies Cat# SMF-WA1-60). Cells were incubated with 100 μL Hybridization buffer containing 1,25 μM of RNA-FISH probes in the dark at 37 °C overnight (~16 hours) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated in a humidified chamber at 37 °C for 14 hours with probes diluted in Stellaris RNA FISH Hybridisation Buffer (LGC Biosearch Technologies; with 10% (v/v) formamide added ...
-
bioRxiv - Molecular Biology 2021Quote: ... Excess buffer was removed and 100 uL of freshly prepared Hybe Buffer Mixture was added (for two color in situs: 85.5 uL of Stellaris® RNA FISH Hybridization Buffer (Biosearch Technologies; Cat #: SMF-HB1-10); 9.5 uL deionized formamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 uL of freshly prepared Hybe Buffer Mixture was added (for two color in situs: 85.5 uL of Stellaris® RNA FISH Hybridization Buffer (Biosearch Technologies; Cat #: SMF-HB1-10); 9.5 uL deionized formamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were then washed once with 1000 uL of freshly prepared Stellaris® Buffer A Mixture (10% deionized formamide; 20% Stellaris® RNA FISH Wash Buffer A (Biosearch Technologies; Cat #: SMF-WA1-60); 70% RNase-free water) ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were subsequently submerged in wash buffer A (10% [v/v] de-ionised formamide, 20% [v/v] Stellaris wash buffer A [LGC Biosearch Technologies, Cat. No. SMF-WA1-60], 70% H2O) for 10–15 minutes ...