Labshake search
Citations for Biosearch Technologies :
1 - 50 of 166 citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Immunology 2021Quote: ... NP(6)-BSA-biotin (Biosearch Technologies) was pre-incubated for 30 min with streptavidin-APC in a 1:1 molar ratio ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Immunology 2019Quote: ... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 recipient mice were pre-immunized by intraperitoneal injection of 100 µg OVA (BioSearch Technologies) dissolved in PBS and precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: All oligonucleotides used in this work (Table S2) were synthesized using a MerMade 6 instrument (LGC, Biosearch Technologies) at 1 μmol scale ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... Re-hydrated samples were hybridized with 62.5 nM of an equimolar mixture of Cy3-labelled DNA probes designed to target the coding region of the gene segment 6 of simian rotavirus A/SA11 (Genbank Acc. AY187029.1) using Stellaris Probe Designer v2 software (LCG Biosearch Technologies), in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... the glass coverslips were transferred to a fresh 6-well plate with the cell side up and incubated with Wash Buffer A (Biosearch Technologies) and Hoechst stain (1:2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Immunology 2023Quote: ... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Immunology 2020Quote: ... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
bioRxiv - Genetics 2020Quote: 4-hydroxy-3-nitrophenylacetic acid succinimide ester (LGC, Biosearch Technologies)
-
bioRxiv - Immunology 2022Quote: ... while TNP-BSA (load 5; LGC BioSearch Technologies) was used for the identification of TNP-specific antibody-secreting cells ...
-
bioRxiv - Genomics 2022Quote: ... 100μg NP-KLH (Biosearch Technologies, N-5060-5) plus 1μg LPS (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Staining was performed with 1 µM Cal Fluor 610 conjugated pals-5 smFISH probes (Biosearch Technologies) in smFISH hybridization buffer (10% formamide ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL Baseline-ZERO™ DNAse enzyme (LGC Biosearch Technologies, Pt# E0110-D1, 1 U/μL), 10 μL 10X Baseline-ZERO™ DNase Reaction Buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... DesignReady Stellaris® probe sets against mCherry (labelled with Quasar®-670, # VSMF-1031-5) and GFP (labelled with Quasar®-570, # VSMF-1014-5) from Biosearch Technologies were used.
-
bioRxiv - Cell Biology 2021Quote: ... 300 μL of the permeabilized cells per hybridization sample were then pelleted (400 g, 7 minutes) and washed in 500 μL of wash buffer A (Biosearch Technologies, SMF-WA1-60 ...
-
bioRxiv - Immunology 2021Quote: ... with 100 μg 4-hydroxy-3-nitrophenyl acetyl (NP)-CGG (Biosearch Technologies) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 56 Subsequent IVT reaction producing 5′-triphosphorylated RNAs was performed with NxGen T7 RNA Polymerase (Biosearch Technologies #30223-1). For segment 8 of IAV MEGAscript T7 Transcription Kit (Thermo #AM1333 ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) was mixed with Alum (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) in PBS was mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: Mice were injected intraperitoneally with 50μg of 4-hydroxy-3-nitrophenylacetyl (NP)-CGG (BioSearch Technologies) in PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylcholine Keyhole Limpet Hemocyanin (PC-KLH, LGC Biosearch Technologies, Cat# PC-1013-5) was applied at a concentration of 100 ng per well ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 100ug of NP(24)-CGG (Cat. N5055C-5, Biosearch technologies) emulsified in alum (Cat ...
-
bioRxiv - Immunology 2021Quote: ... or 50 ug of alum-precipitated 4-Hydroxy-3-nitrophenylacetyl (NP)-chicken gamma globulin (CGG) (Biosearch Technologies). For adoptive transfer experiments ...
-
bioRxiv - Immunology 2021Quote: ... and incubating with anti-Ki-67 or 4-hydroxy-3-nitrophenylacetyl conjugated to phycoerythrin (NP-PE) (Biosearch Technologies) in Perm/Wash buffer for 30 min ...
-
bioRxiv - Immunology 2019Quote: Mice were immunized intra-peritoneally with 25 μg of 4-hydroxy-3-nitrophenylaceyl-lipopolysaccharide (NP-LPS) (Biosearch Technologies). Blood ...
-
bioRxiv - Genomics 2020Quote: ... coverslips were incubated for 5 minutes in Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), followed by hybridization overnight at 37°C with 250 nM of each FISH probe in 50 μl Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Genetics 2024Quote: Stellaris® FISH Probes recognizing either the coding region of eGFP mRNA or GAPDH mRNA labeled with Quasar® 670 Dye (VSMF-1015-5 for eGFP and SMF-2019-1 for GAPDH, from Biosearch Technologies, Inc., Petaluma, CA) were hybridized to HEK293T cell lines expressing integrated eGFP reporters with different length 3′UTRs according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100µg of 4-Hydroxy-3-nitrophenylacetyl hapten-17 (NP17)-OVA (Biosearch Technologies, 1µg/mL) mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...