Labshake search
Citations for Biosearch Technologies :
51 - 100 of 127 citations for 6 Chloro 4 methyl 1 benzothiophen 3 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2022Quote: In vitro BCR stimulation with cognate antigen was performed by adding NP(4)BSA (Biosearch Technologies), NP(25)BSA (Biosearch Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with NP3– or NP14–bovine serum albumin (BSA; Biosearch Technologies), diluted in carbonate buffer ...
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA in situ hybridisation in adult ventral nerve cords for the precursor RNA transcripts of miR-iab-4 was performed by designing 48 unique 20nt-probes labelled with Quasar 570 in the Stellaris platform from Biosearch Technologies, and using an adapted version of the protocol by Raj A ...
-
bioRxiv - Immunology 2021Quote: ... for ELISPOT assays were prepared with 35% ethanol and then coated overnight at 4 °C with TNP-BSA or NP-BSA (Biosearch Technologies). Plates were washed and subsequently blocked at 37 °C with complete culture media prior to plating and culturing splenocytes or bone marrow cells for 18 h at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2020Quote: ... Custom Stellaris FISH Probes were designed against target transcripts (Supplementary Table 4) by utilizing the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner (version 4.2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...
-
bioRxiv - Cell Biology 2024Quote: GAPDH smFISH probe (Biosearch Technologies Inc.: SMF-2026-1). All other probes were generated using Stellaris probe design tool.
-
bioRxiv - Molecular Biology 2023Quote: Assay mixes were prepared in 16 μL volumes for each unique crRNA target consisting of 1 μL of 50 U/μL NxGen T7 Polymerase (Biosearch Technologies 30223-1), 2 μL of 800 nM LwaCas13a (Genscript) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a Stellaris FISH probe (Biosearch Technologies, SMF-2038-1), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... we used a Stellaris probe (Biosearch Technologies, SMF-2038-1) to detect XIST RNA ...
-
bioRxiv - Immunology 2021Quote: ... or 100 ug NP-CGG (conjugation ratio 20-29:1) (Biosearch Technologies) in Imject Alum (Thermofisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... After electroporation transformation with Endura Electrocompetent Cells (60242-1, Biosearch Technologies, USA), the cells were plated into Nunc™ Square BioAssay Dishes (Catalog number ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... lag-1 Stellaris smFISH probes were designed by and obtained from Biosearch Technologies. The fixed dissected gonads were incubated with probe at final concentration of 5 µM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Single-molecule FISH probes except for the POLR2A (SMF-2006-1, Biosearch Technologies) and firefly luciferase mRNA single-molecule FISH probes (Matheny et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cleaned assembly reactions were electroporated into Endura Electrocompetent cells (Biosearch Technologies 60242-1) according to manufacturer’s instructions and plated on LB-Lennox 250 mm x 250 mm square bioassay dishes supplemented with 75 µg/mL carbenicillin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and erm-1 mRNAs using the Stellaris FISH Probe Designer (Biosearch Technologies, Petaluma, CA). Probes against other mRNAs were designed following the smiFISH approach as previously described (Tsanov et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 29 probes for kni) were designed (Supplementary Table 1) and synthesized (Biosearch Technologies). Each probe was ordered with a 3’ amine group (mdC(TEG-Amino) ...
-
bioRxiv - Immunology 2020Quote: ... NP25-PE or NP23-PE was used at 1:200 dilution (LGC Biosearch Technologies).
-
bioRxiv - Immunology 2020Quote: ... NP(1-9)-BSA or NP(>20)-BSA (N-5050L, N-5050H, Biosearch Technologies) at 50 μg/mL in 25 μL PBS ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then washed with 1 ml of Wash Buffer B (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of Hybridase Thermostable RNase H at 45°C (Lucigen (now Biosearch Technologies), Cat ...