Labshake search
Citations for Biosearch Technologies :
51 - 100 of 181 citations for 6 CHLORO 1 2 4 TRIAZOLO 4 3 B PYRIDAZINE 3 THIOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Cover glasses were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then resuspended in 1 mL wash buffer B (Biosearch Technologies, SMF-WB1-20), incubated for 2-5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... After washing with 1 mL of Stellaris® RNA FISH wash buffer B (Biosearch Technologies) cells were mounted in Vectashield® mounting medium (Vector Laboratories) ...
-
bioRxiv - Immunology 2022Quote: In vitro BCR stimulation with cognate antigen was performed by adding NP(4)BSA (Biosearch Technologies), NP(25)BSA (Biosearch Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with NP3– or NP14–bovine serum albumin (BSA; Biosearch Technologies), diluted in carbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... then in 1 mL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with Hoescht stain at 1:10,000 dilution for 5 min at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2022Quote: ... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Coverslips were incubated in buffer B (Biosearch Technologies) containing DAPI for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then washed with Buffer B (Biosearch Technologies) for 10 minutes at room temperature.
-
bioRxiv - Cell Biology 2022Quote: ... and Wash Buffer B (Biosearch Technologies, SMF-WB1-20) are purchased from Biosearch Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and Wash B Buffers were purchased from Biosearch Technologies. Hoechst stain was purchased from AnaSpec ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA in situ hybridisation in adult ventral nerve cords for the precursor RNA transcripts of miR-iab-4 was performed by designing 48 unique 20nt-probes labelled with Quasar 570 in the Stellaris platform from Biosearch Technologies, and using an adapted version of the protocol by Raj A ...
-
bioRxiv - Immunology 2021Quote: ... for ELISPOT assays were prepared with 35% ethanol and then coated overnight at 4 °C with TNP-BSA or NP-BSA (Biosearch Technologies). Plates were washed and subsequently blocked at 37 °C with complete culture media prior to plating and culturing splenocytes or bone marrow cells for 18 h at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Immunology 2021Quote: ... NP(6)-BSA-biotin (Biosearch Technologies) was pre-incubated for 30 min with streptavidin-APC in a 1:1 molar ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... Additional washing step with Stellaris Wash Buffer B (Biosearch Tech) was performed for 5 min at RT before mounting the samples on the glass slides.
-
bioRxiv - Cell Biology 2023Quote: ... Hoechst stain was washed with Wash Buffer B (Biosearch Technologies) at room temperature in the dark for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and nuclear counterstaining was performed using 1:10000 Hoechst 33342 in buffer A followed by two washings in buffer B (Stellaris RNA FISH Wash Buffer B (Biosearch Tech. Cat# SMF-WB1-20) and mounting the coverslips with mowiol.
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Custom Stellaris FISH Probes were designed against target transcripts (Supplementary Table 4) by utilizing the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner (version 4.2) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were then washed in 500 μL Wash Buffer B (Biosearch Technologies), and resuspended in 50 μL freshly filtered 5× saline-sodium citrate (SSC ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubated with wash B buffer (Biosearch Technologies, SMF-WB1-20) at RT for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... and stored in Wash Buffer B (LGC Biosearch Technologies, SMF-WB1-20) for imaging ...
-
bioRxiv - Cell Biology 2022Quote: ... and stored in Wash Buffer B (Cat# SMF-WA1-60, LGC Biosearch Technologies) for imaging ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were washed with wash buffer B (Biosearch Technologies, Cat# SMF-WB1-20) and resuspend in a small drop (approximately 30 µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated with Wash Buffer B (cat. # SMF-WB1-20, Biosearch technologies) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... and then washed once with wash buffer B (Biosearch Technologies, SMF-WB1-20) before imaging.
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were washed in Wash Buffer B (Biosearch Technologies SMF-WB1-20) for 5 minutes at room temperature in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted 1:6 in nuclease free H2O and 5 µl were used for Kompetitive allele specific PCR (KASP) genotyping (LGC Biosearch Technology) (Supplementary Table 3) ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 15 min and washed in RNA FISH Wash Buffer B (LGC Biosearch Technologies) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... Then the cells were washed briefly with Stellaris RNA FISH wash buffer B (Biosearch Technologies), rinsed three times with PBS and subject to imaging by deconvolution microscopy (DeltaVision OMX SR imaging system) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were then washed with Wash Buffer B (Biosearch Technologies, Inc., SMF-WA1-60) for 5 min ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Cell Biology 2023Quote: ... washed with 500 μL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies, SMF-WB1-20), and incubated in 500 μL Stellaris RNA FISH Wash Buffer B for 5 min at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... and finally with Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) for 5 minutes at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed with 200 μL of wash buffer B (Biosearch Technologies Cat# SMF-WB1-20) and incubated with it at room temperature for 2-5 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... at 37°C and then once with Stellaris wash buffer B (Biosearch technologies SMF-WB1-20) for three minutes at room temperature ...