Labshake search
Citations for Biosearch Technologies :
1 - 50 of 70 citations for 5 Fluoro 2 piperidin 2 yl 1H benzimidazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Genomics 2023Quote: ... Next the samples were transformed into electrocompetent cells (Biosearch Technologies, 60242-2). One 0.1cm cuvette (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were washed with 2 mL of wash buffer A (LGC Biosearch Technologies) supplemented with 10% deionized formamide (Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were then washed with 2 mL of Wash buffer A (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: The lysate was incubated with 2 U of RNase I (LGC Biosearch Technologies, low), 10 U of RNase I (high) ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 smFISH probes were designed using Stellaris smFISH probe designer (Biosearch Technologies) available online at http://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies) and subjected again to the Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... while TNP-BSA (load 5; LGC BioSearch Technologies) was used for the identification of TNP-specific antibody-secreting cells ...
-
bioRxiv - Genomics 2022Quote: ... 100μg NP-KLH (Biosearch Technologies, N-5060-5) plus 1μg LPS (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Cell Biology 2024Quote: ... DesignReady Stellaris® probe sets against mCherry (labelled with Quasar®-670, # VSMF-1031-5) and GFP (labelled with Quasar®-570, # VSMF-1014-5) from Biosearch Technologies were used.
-
bioRxiv - Immunology 2019Quote: ... 7 and 14 with NP-KLH (N-5060-5 Biosearch Technologies) or PBS as a control ...
-
bioRxiv - Cell Biology 2022Quote: Human MYC_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2066-5), human ACTB_intron with Quasar 570 dye (Biosearch Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... human ACTB_intron with Quasar 570 dye (Biosearch Technologies, ISMF-2002-5), Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) was mixed with Alum (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... 50μg NP(30-39)-CGG (Biosearch Tech, cat: N-5055D-5) in PBS was mixed with Imject Alum (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescent probe (5’-6FAM-TTGACAGGCAAACAGCACAAGCAG-BHQ1-3’) (Biosearch Technologies, Novato, CA, USA). The QPCR reactions were carried out at 50 °C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... and custom synthesized conjugated with Quasar-670 dye (Biosearch Technologies, #SMF-1065-5). The pool of FISH probe set (5 nmol ...
-
bioRxiv - Immunology 2023Quote: ... Phosphorylcholine Keyhole Limpet Hemocyanin (PC-KLH, LGC Biosearch Technologies, Cat# PC-1013-5) was applied at a concentration of 100 ng per well ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized with 100ug of NP(24)-CGG (Cat. N5055C-5, Biosearch technologies) emulsified in alum (Cat ...
-
bioRxiv - Genomics 2020Quote: ... coverslips were incubated for 5 minutes in Stellaris RNA FISH Wash Buffer A (Biosearch Technologies), followed by hybridization overnight at 37°C with 250 nM of each FISH probe in 50 μl Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Immunology 2021Quote: ... Staining was performed with 1 µM Cal Fluor 610 conjugated pals-5 smFISH probes (Biosearch Technologies) in smFISH hybridization buffer (10% formamide ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL Baseline-ZERO™ DNAse enzyme (LGC Biosearch Technologies, Pt# E0110-D1, 1 U/μL), 10 μL 10X Baseline-ZERO™ DNase Reaction Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).