Labshake search
Citations for Biosearch Technologies :
51 - 100 of 126 citations for 3 Phenoxybenzoic Acid Unlabeled 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 50 ng/ml NIP-15-BSA (Biosearch Technologies) was added to the media bath and images were collected after a short incubation of about 5 min and proceeded for about 30 min ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... we resuspended the pellet from each sample in 750 mL of chilled resuspension buffer (1X PBS, 0.4 mg/mL BSA, 0.2 U/μL RNAse Inhibitor [Biosearch Technologies, Cat. 30281]) containing one of 8 unique XPoSE-tags (Nucleoporin 62 antibody conjugated to R718 fluorescent dye and one of eight distinct oligo-based Sample Tags (ST ...
-
bioRxiv - Immunology 2021Quote: 7-9 week old mice were immunized with 4-hydroxy-3-nitrophenol–Keyhole Limpet Hemocyanin (NP-KLH) (Biosearch Technologies). NP-KLH was premixed in a 1:1 mixture of PBS ...
-
bioRxiv - Immunology 2022Quote: ... we employed a prime-boost approach in which 8-10 wk old age and sex matched mice were immunized intraperitoneally (i.p.) with 200µg of 4-Hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyanin (NP-KLH, Biosearch Technologies) mixed with Complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Cell Biology 2021Quote: ... Permeabilized cells were then resuspended in 100 μL hybridisation solution (Biosearch Technologies, SMF-HB1-10) containing 1-3x of standard probe concentrations for WHI5 and MDN1 probes ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 recipient mice were pre-immunized by intraperitoneal injection of 100 µg OVA (BioSearch Technologies) dissolved in PBS and precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: 2-4 months old mice were immunized intraperitoneally with 100 μg of NP18-OVA (Biosearch technologies) in Imject Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Genomics 2020Quote: ... Six to eight week old mice were immunized intraperitoneally with 100 µg NP(23)-KLH (Biosearch Technologies) mixed with 50% (v/v ...
-
bioRxiv - Genetics 2023Quote: ... and then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs were then run in a thermocycler for three consecutive cycles ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Immunology 2020Quote: Mice were immunized with 50μg of NP-KLH (4-hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyaninin; conjugation ratio 29-33, Biosearch technologies N-5060) dissolved in PBS at 2mg/mL and emulsified at a 1:1 ratio with Imject Alum Adjuvant (ThermoFisher Scientific 77161) ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
bioRxiv - Genomics 2022Quote: ... The cell suspension was further incubated with biotinylated 4-Hydroxy-3-iodo-5-nitrophenylacetyl (NIP)15-BSA (Biosearch Technologies, N-1027-5) for 1.5h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs and PBMCs were then run in a thermocycler for one round of three consecutive cycles ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were washed with 2 mL of wash buffer A (LGC Biosearch Technologies) supplemented with 10% deionized formamide (Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Immunology 2022Quote: ... were coated with NP3-BSA or NP14-BSA (10 mg/ml, Biosearch Technologies) in carbonate buffer (0.1 M NaHCO3 ...
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... chimeric mice were immunized intravenously with 10 μg/ml NP-Ficoll (Biosearch Technologies) in 100 μl PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... the brains were incubated with the custom-made Stellaris Venus or GFP probes (100 nM; see Supporting Information Text for the sequences; LGC BioSearch Technologies) and the primary antibody (mouse anti-Repo (1:100 ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated with TNP(65)-FL-AECM-Ficoll (20μg/ml; Biosearch Technologies Inc.) prior to performing extracellular staining ...