Labshake search
Citations for Biosearch Technologies :
151 - 181 of 181 citations for 6 Heptenoic acid 7 2 cyclopropyl 4 4 fluorophenyl 3 quinolinyl 3 5 dihydroxy calcium salt 1 1 3R 5S 6E since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: We designed 48 Custom Stellaris FISH Probes against slow-1 mRNA using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Genomics 2019Quote: ... We then washed the coverslips with 2 mL of Wash buffer A (LGC Biosearch Technologies) at room temperature for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and SARS-CoV-2 smFISH probes were designed using Stellaris smFISH probe designer (Biosearch Technologies) available online at http://www.biosearchtech.com/stellaris-designer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).
-
bioRxiv - Microbiology 2021Quote: ... A final wash step was performed using Wash buffer B (Biosearch Technologies Cat# SMF-WB1-2) for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Custom probes were designed against the exons of the eff-1 gene by utilizing the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). The probes were hybridized with the dye Cy5 (Huelsz-Prince and van Zon 2017) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Developmental Biology 2024Quote: ... and kl-2 exons were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc.) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Molecular Biology 2023Quote: ... All SSOs used are RNA oligonucleotides with 2’-O-methyl modifications and phosphorothioate backbones (LGC Biosearch Technologies; Risskov, Denmark) (Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: HUDEP-2 cells were washed with PBS and DNA extracted using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... smFISH probes consisting of 20 nt oligonucleotides with 2 nt spacing were designed with Stellaris Probe Designer and synthesized by Biosearch Technologies. Probe sets complementary to cycB (CG3510 ...
-
bioRxiv - Microbiology 2021Quote: ... The abundance of SARS-CoV-2 genetic material was subsequently determined by quantitative PCR using a Taqman probe and primers (Biosearch Technologies). The primers and probe sequences for the were as recommended by BEI resources for compatability with synthetic RNA standards (# NR-52358).
-
bioRxiv - Genomics 2024Quote: ... The assembled plasmid pool was purified and concentrated with AMPure XP SPRI Reagent and used for transformation of Electrocompetent Endura Cells (#60242-2, Biosearch Technologies) following manufacturer’s instructions and a previously published protocol47 ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were washed with Stellaris Wash Buffer A solution (2 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies SMF-WA1-60), 7 mL Nuclease-free water ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 25 µl of 10 µg/ml NP-BSA in PBS (N-5050XL-10-BS with loading ratio of 2 or N-5050H-10-BS with loading ratio of 36, both Biosearch Technologies/BioCat) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Genetics 2022Quote: ... and stored at 4°C for several days. A lag-2 RNA probe set (Barkoulas et al. 2013) coupled to AF594 (Custom Stellaris Fish Probes, Biosearch Tech, Teddington UK) was resuspended in RNase-free TE buffer (pH8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 genome equivalents were quantified in culture supernatant by RT-qPCR using 2019-nCoV CDC probe and Primer Kit for SARS-CoV-2 (Biosearch Technologies, KIT-nCoV-PP1-1000). Forward primer ...