Labshake search
Citations for Biosearch Technologies :
101 - 150 of 154 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2020Quote: ... Custom Stellaris FISH Probes were designed against target transcripts (Supplementary Table 4) by utilizing the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner (version 4.2) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...
-
bioRxiv - Cell Biology 2024Quote: GAPDH smFISH probe (Biosearch Technologies Inc.: SMF-2026-1). All other probes were generated using Stellaris probe design tool.
-
bioRxiv - Molecular Biology 2023Quote: Assay mixes were prepared in 16 μL volumes for each unique crRNA target consisting of 1 μL of 50 U/μL NxGen T7 Polymerase (Biosearch Technologies 30223-1), 2 μL of 800 nM LwaCas13a (Genscript) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a Stellaris FISH probe (Biosearch Technologies, SMF-2038-1), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... we used a Stellaris probe (Biosearch Technologies, SMF-2038-1) to detect XIST RNA ...
-
bioRxiv - Immunology 2021Quote: ... or 100 ug NP-CGG (conjugation ratio 20-29:1) (Biosearch Technologies) in Imject Alum (Thermofisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... After electroporation transformation with Endura Electrocompetent Cells (60242-1, Biosearch Technologies, USA), the cells were plated into Nunc™ Square BioAssay Dishes (Catalog number ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... lag-1 Stellaris smFISH probes were designed by and obtained from Biosearch Technologies. The fixed dissected gonads were incubated with probe at final concentration of 5 µM ...
-
bioRxiv - Cancer Biology 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Genomics 2019Quote: ... Coverslips were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Single-molecule FISH probes except for the POLR2A (SMF-2006-1, Biosearch Technologies) and firefly luciferase mRNA single-molecule FISH probes (Matheny et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cleaned assembly reactions were electroporated into Endura Electrocompetent cells (Biosearch Technologies 60242-1) according to manufacturer’s instructions and plated on LB-Lennox 250 mm x 250 mm square bioassay dishes supplemented with 75 µg/mL carbenicillin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and erm-1 mRNAs using the Stellaris FISH Probe Designer (Biosearch Technologies, Petaluma, CA). Probes against other mRNAs were designed following the smiFISH approach as previously described (Tsanov et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 29 probes for kni) were designed (Supplementary Table 1) and synthesized (Biosearch Technologies). Each probe was ordered with a 3’ amine group (mdC(TEG-Amino) ...
-
bioRxiv - Immunology 2020Quote: ... NP25-PE or NP23-PE was used at 1:200 dilution (LGC Biosearch Technologies).
-
bioRxiv - Immunology 2020Quote: ... NP(1-9)-BSA or NP(>20)-BSA (N-5050L, N-5050H, Biosearch Technologies) at 50 μg/mL in 25 μL PBS ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then washed with 1 ml of Wash Buffer B (LGC Biosearch Technologies) at RT for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of Hybridase Thermostable RNase H at 45°C (Lucigen (now Biosearch Technologies), Cat ...
-
bioRxiv - Genomics 2023Quote: ... Cover glasses were washed with 1 mL of wash buffer B (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ninety-six-well plates were coated with 1 μg/ml NP-BSA (Biosearch Technologies) in bicarbonate buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then resuspended in 1 mL wash buffer B (Biosearch Technologies, SMF-WB1-20), incubated for 2-5 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed with 1 ml of Wash buffer A (Biosearch Technologies, SMF-WA1-60). To probe for S4 mRNA ...
-
bioRxiv - Immunology 2021Quote: ... with 50 ug NP-Ficoll (conjugation ratio 55:1) in 100 uL saline (Biosearch Technologies) or 100 ug NP-CGG (conjugation ratio 20-29:1 ...
-
bioRxiv - Cell Biology 2023Quote: ... After washing with 1 mL of Stellaris® RNA FISH wash buffer B (Biosearch Technologies) cells were mounted in Vectashield® mounting medium (Vector Laboratories) ...
-
bioRxiv - Molecular Biology 2020Quote: ... then in 1 mL Stellaris RNA FISH Wash Buffer B (Biosearch Technologies Cat# SMF-WB1-20) with Hoescht stain at 1:10,000 dilution for 5 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... the buffer was supplemented with 1 U/µl of an RNase inhibitor (302811, LGC Biosearch Technologies).
-
bioRxiv - Genetics 2022Quote: ... slow-2 and pgl-1 using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Genetics 2023Quote: ... and then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs were then run in a thermocycler for three consecutive cycles ...
-
bioRxiv - Genomics 2020Quote: ... NIC203 and EG6180 embryos were hybridised with slow-1 probes labeled with Quasar® 570 (Biosearch Technologies, Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5X sample premixes were created with 2.4 μL of 10X T7 Buffer (Biosearch Technologies F88905-1, Hoddesdon, United Kingdom), 3.2 μL of 7.5X sample buffer ...
-
bioRxiv - Genomics 2024Quote: ... and recovering for 90 minutes at 30 °C in 1 mL of Endura recovery media (Biosearch Technologies 60242-2). Cultures were then grown for 16 hours in 50 mL of 2xYT media with 100 µg/mL of carbenicillin ...
-
bioRxiv - Systems Biology 2020Quote: ... and hybridized with Stellaris FISH probes labeled with Quasar 570 or Quasar 670 at 125nM (Biosearch Technologies, Supplementary Table 1) overnight at 30°C in Hybridization Buffer (containing 20% Formamide (Ambion AM9342) ...
-
bioRxiv - Genetics 2023Quote: ... The cell pellet was then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs and PBMCs were then run in a thermocycler for one round of three consecutive cycles ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent heat shock and were hybridized for 2 h at 38.5 °C in a humidity chamber with XIST Quasar 570 (125 nM; SMF-2038-1; BioSearch Technologies) in a hybridization buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was conducted using EconoTaq PLUS 2X Master mix (Cat no. 30035-1, Lucigen, LGC Biosearch technologies, USA) as follow ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 70% ethanol was then removed and 1 mL Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60) with 10% deionized formamide for 5 min at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The probes for the coronavirus assays (E/IP4) were both labelled with a FAM reporter and black hole quencher 1 (Biosearch Technologies) and the XIPC probe with a Vic reporter and TAMRA quencher (Life Technologies ...