Labshake search
Citations for Biosearch Technologies :
101 - 150 of 218 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
bioRxiv - Molecular Biology 2023Quote: Two sets of 3’-end biotinylated RNA oligonucleotides (LGC Biosearch Technologies; Risskov, Denmark) (Table S3 ...
-
bioRxiv - Genomics 2021Quote: Hybridization mix (200 nM probes in Stellaris hybridization buffer, Biosearch Technologies Cat# SMF-HB1-10 and 10% Formamide) was added after aspirating the wash buffer A and the sample was incubated upside-down facing the buffer at 37°C in the dark for about 18–24 h (within assembled humidified chamber) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to BHQ-10 succinimidyl ester (Biosearch Technologies). In a typical reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Developmental Biology 2019Quote: ... ovaries were washed twice with Wash Buffer A at 37 °C for 30 minutes and once with Wash Buffer B (LGC Biosearch Tech, Cat# SMF-WB1-20) at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Immunology 2023Quote: Mice were immunized by subcutaneous injection into the hind footpad of 10 μg OVA or 10 μg NP-OVA (Biosearch Technologies) adsorbed in alum (Imject Alum ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... diluted in Hybridization Buffer (Biosearch Technologies SMF-HB1-10) plus 10% Deionized Formamide (Millipore 4610) ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... before adding 200μl hybridization buffer (Biosearch Technologies, SMF-HB1-10) containing the U1 probe and covering the tissue with a glass coverslip ...
-
bioRxiv - Cell Biology 2022Quote: ... Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), Stellaris RNA FISH Wash Buffer A (Biosearch Technologies ...
-
bioRxiv - Immunology 2021Quote: ... or intravenously with 50 μg NP-Ficoll (Biosearch Technologies; F-1420-10). For influenza infections ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Immunology 2022Quote: ... were coated with NP3-BSA or NP14-BSA (10 mg/ml, Biosearch Technologies) in carbonate buffer (0.1 M NaHCO3 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 10 μg NP(19)-OVA (NP-OVA, Biosearch Technologies) absorbed in alum or 25 μg NP-OVA ...
-
bioRxiv - Immunology 2022Quote: ... chimeric mice were immunized intravenously with 10 μg/ml NP-Ficoll (Biosearch Technologies) in 100 μl PBS ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated with 50 µl Hybridization Buffer (LGC Biosearch Tech, Cat# SMF-HB1-10) containing RNA probe set overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then proceeded for hybridization with 100ul hybridization buffer (Biosearch Technologies, Cat# SMFHB1-10) containing Hmrhl probe (working concentration 125 nM ...
-
bioRxiv - Immunology 2019Quote: ... Plates were coated with 10 μg/mL NP31-bovine serum albumin (BSA, Biosearch Technologies) and blocked with PBS 3 % BSA ...
-
bioRxiv - Cell Biology 2021Quote: ... Permeabilized cells were then resuspended in 100 μL hybridisation solution (Biosearch Technologies, SMF-HB1-10) containing 1-3x of standard probe concentrations for WHI5 and MDN1 probes ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were hybridized with 80 μl of hybridization buffer (LGC Biosearch Technologies, SMF-HB1-10) supplemented with 10% deionized formamide containing the FISH probes at a 1:100 dilution at 37°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were incubated in Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10) with 10% deionized formamide and 125 µM Quasar 640-labeled oligonucleotide probes ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Microbiology 2021Quote: ... cells were then incubated with S4 probes diluted in Hybridization buffer (Biosearch Technologies, SMF-HB1-10) in a humidified chamber at 37°C for 4 h in the dark ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Coverslips were that moved to hybridization buffer containing 90% Stellaris hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide ...
-
bioRxiv - Cell Biology 2019Quote: ... 2ul of stellaris probes were diluted in 100ul of Stellaris hybridization buffer (Biosearch technologies SMF-HB1-10). Samples were hybridized overnight at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated in Hybridization buffer (90% Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10) and 10% Deionized Formamide ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... Dll4 mRNA and Notch1 mRNA probes were mixed with the hybridization buffer (cat. # SMF-HB1-10, Biosearch technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed with 10% v/v formamide in Stellaris® RNA FISH wash buffer A (Biosearch Technologies) and incubated in 1 mL of DAPI staining solution (5 ng/mL DAPI in wash buffer A with 10% v/v formamide ...