Labshake search
Citations for Biosearch Technologies :
51 - 100 of 136 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and each probe was synthesized with a 3’ amino modification (LGC Biosearch Technologies, CA) (Table S3) ...
-
bioRxiv - Genetics 2023Quote: ... The probes with 3’ MdC(TEG-Amino) modifications were then ordered from Biosearch Technologies in 96-well plate format ...
-
bioRxiv - Cell Biology 2023Quote: ... with 100 U of NxGen RNase inhibitor (LGC Biosearch technologies, 30281), 2 U of beta-agarose I (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... (5’ – TCA GTC TTC CGA CCA TTG – 3’)31,57 and was manufactured by Biosearch Technologies, Petaluma ...
-
bioRxiv - Genomics 2022Quote: ... The 3’ end of each oligonucleotide probe was fluorescently tagged using Quasar dyes (Biosearch technologies). Bl6-specific oligos were labelled with Quasar 570 and Cast-specific oligos labelled with Quasar 670 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Custom 20 nt oligonucleotides with a 3’NHS ester modification were obtained from Biosearch Technologies, conjugated to either Atto 565 (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... Cells were hybridized with 100 μL of hybridization buffer (LGC Biosearch Technologies) containing the FISH probes at a 1:100 dilution in a humid chamber at 37 °C overnight up to 16 hours ...
-
bioRxiv - Genomics 2021Quote: ... 2021) and ordered oligonucleotides with a primary amine group on the 3’ end from Biosearch Technologies (see Supplementary Table 2 for probe sequences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... A glr-4 probe was designed using the Stellaris Probe Designer website (Biosearch Technologies). The probe was mixed in hybridization buffer (0.1 g/ml dextran sulfate [Sigma D8906-50G] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were then incubated with 100 μl Stellaris hybridization buffer (Biosearch Technologies) containing Stellaris RNA FISH probes (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cells were then incubated with 100 μl Stellaris hybridization buffer (Biosearch Technologies) containing Stellaris RNA FISH probes (Biosearch Technologies ...
-
bioRxiv - Genomics 2022Quote: ... Cells were subsequently hybridized with 100 μl of Hybridization Buffer (LGC Biosearch Technologies) containing the smRNA-FISH probes at a 1:100 dilution in a humid chamber at 37°C o/n (not more than 16 h) ...
-
bioRxiv - Immunology 2023Quote: ... 100 μg or 20 μg NP-OVA (Biosearch Technologies, 20 μg for recall) mixed with 2 μg LPS (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... to a 24mer DNA oligo containing a Quasar 670 (Cy5) fluorophore at the 3’ end (Biosearch Technologies) that was purified as described previously (He et al. ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally with 100 μg NP-CGG (ratio 30–39; Biosearch Technologies) resuspended in Imject™ Alum adjuvant (Thermo Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... recipient mice were immunized by intraperitoneal injection of 100 µg NP19-OVA (BioSearch Technologies) precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... mice were injected intraperitoneally (i.p.) with 100 µg of NP-CGG (LGC Biosearch Technologies) in 200 µL of alum (Thermo Scientific ...
-
bioRxiv - Immunology 2023Quote: ... mice were immunized intraperitoneally with 100 μg NP-KLH (conjugate ratios:220, Biosearch Technologies) mixed with 1 μg lipopolysaccharide (LPS ...
-
bioRxiv - Immunology 2019Quote: ... at 10µg/ml or NP20-BSA (Biosearch Technologies) at 2.5µg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 ng/ml NIP-15-BSA (Biosearch Technologies) was added to the media bath and images were collected after a short incubation of about 5 min and proceeded for about 30 min ...
-
bioRxiv - Immunology 2024Quote: ... or NP25-BSA (Biosearch Technologies, 5 μg/ml) to capture all murine Igs or NP-specific antibodies ...
-
bioRxiv - Immunology 2022Quote: In vitro BCR stimulation with cognate antigen was performed by adding NP(4)BSA (Biosearch Technologies), NP(25)BSA (Biosearch Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with NP3– or NP14–bovine serum albumin (BSA; Biosearch Technologies), diluted in carbonate buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... we resuspended the pellet from each sample in 750 mL of chilled resuspension buffer (1X PBS, 0.4 mg/mL BSA, 0.2 U/μL RNAse Inhibitor [Biosearch Technologies, Cat. 30281]) containing one of 8 unique XPoSE-tags (Nucleoporin 62 antibody conjugated to R718 fluorescent dye and one of eight distinct oligo-based Sample Tags (ST ...
-
bioRxiv - Cell Biology 2021Quote: ... Permeabilized cells were then resuspended in 100 μL hybridisation solution (Biosearch Technologies, SMF-HB1-10) containing 1-3x of standard probe concentrations for WHI5 and MDN1 probes ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Immunology 2021Quote: ... C57BL/6 recipient mice were pre-immunized by intraperitoneal injection of 100 µg OVA (BioSearch Technologies) dissolved in PBS and precipitated in alum (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Custom Stellaris FISH probes were designed to recognize NL4-3 HIV-1 gag-pol reading frame nucleotides 386-4456 using the Stellaris RNA FISH Probe Designer 4.1 (Biosearch Technologies, Inc.) available online ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Cell Biology 2021Quote: ... S4 cDNA was detected using a fluorogenic probe (5′-FAM [fluorescent fluorescein]-AGCGCGCAAGAGGGATGGGA-BHQ [black hole quencher]-1-3′; Biosearch Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... Conjugated X FLAP oligos (CACTGAGTCCAGCTCGAAACTTAGGAGG) that were 5′ and 3′ end-labelled with Quasar 570 or Cal Fluor 610 were synthesized by Biosearch Technologies. FLAP-X oligos 5′ and 3′ end labelled with Cy5 or Cy3 were synthesized by IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Cancer Biology 2022Quote: ... at the 5′ end as the reporter fluorophore and with Black Hole Quencher 1 (BHQ1) at the 3′ end as the quencher (Biosearch Technologies). qPCR reactions were performed in a 20-µL volume containing 100 ng genomic DNA template (estimated by UV spectrophotometry ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The FLAP labels contained CAL Fluor 610 or Quasar 670 modifications at both the 5’ and 3’ ends of the following sequence: 5’AATGCATGTCGACGAGGTCCGAGTGT3’ (Biosearch Technologies). One µL of annealed probe solution targeting RNA1 and 1 µL of annealed probe solution targeting RNA2 was then mixed with 98 µL of Hybridization Buffer (100 µL Stellaris FISH hybridization buffer ...
-
bioRxiv - Genomics 2020Quote: ... Six to eight week old mice were immunized intraperitoneally with 100 µg NP(23)-KLH (Biosearch Technologies) mixed with 50% (v/v ...
-
bioRxiv - Genetics 2023Quote: ... and then resuspended with 100 µL per 1 million cells of QuickExtract (Pt#SS000035-D1 Biosearch Technologies). The hiPSCs were then run in a thermocycler for three consecutive cycles ...
-
bioRxiv - Immunology 2024Quote: ... Immunization was performed by intraperitoneal injection of 100 µg of NP-CGG (Biosearch Technologies; ratio 10-20) precipitated in alum (Sigma).
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Microbiology 2019Quote: ... genomic RNA was detected with a 5’ 6-carboxyfluorescein (FAM) and 3’ black hole quencher 1 (BHQ-1) labeled probe targeting nsp2 (Biosearch Technologies, Petaluma, CA), and RNA copy number was calculated by reference to an RNA standard derived from the MHV A fragment ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL Hybridization Buffer (90 μL Stellaris® RNA FISH Hybridization Buffer (Cat# SMF-HB1-10, LGC Biosearch Technologies), 10 μL deionized formamide ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated in 1 mL of wash buffer A (Biosearch Technologies) for 5 min ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA in situ hybridisation in adult ventral nerve cords for the precursor RNA transcripts of miR-iab-4 was performed by designing 48 unique 20nt-probes labelled with Quasar 570 in the Stellaris platform from Biosearch Technologies, and using an adapted version of the protocol by Raj A ...
-
bioRxiv - Immunology 2021Quote: ... for ELISPOT assays were prepared with 35% ethanol and then coated overnight at 4 °C with TNP-BSA or NP-BSA (Biosearch Technologies). Plates were washed and subsequently blocked at 37 °C with complete culture media prior to plating and culturing splenocytes or bone marrow cells for 18 h at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... After fixation with 4% PFA cells were permeabilized by incubation in 70% EtOH for at least 1 hr at 4°C followed by incubation in Stellaris Wash Buffer A (Biosearch Tech) for 5 min at RT ...