Labshake search
Citations for Biosearch Technologies :
51 - 94 of 94 citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Microbiology 2019Quote: ... in a total volume of 200 µl of the hybridization buffer (Stellaris RNA FISH hybridization buffer, SMF-HB1-10, Biosearch Technologies, supplemented with 10% v/v of deionized formamide) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were washed twice with 10% deionized formamide in 2X SSC for 30 min at 37°C and once with Wash B (Biosearch Technologies) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were then washed with smFISH wash buffer (10% v/v formamide, 2X SSC in DPBS) and hybridized with smFISH probes (Biosearch Technologies) in hybridization buffer (0.1 g/mL dextran sulfate ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 100 μl of hybridization buffer (100 mg/ml dextran sulfate, 10–15% formamide, 2× SSC) containing 125 nM Stellaris probes (LGC Biosearch Technologies) for 48 h.
-
bioRxiv - Molecular Biology 2023Quote: mRNA was isolated using Master Pure Complete DNA&RNA purification kit (Biosearch technologies) according to the manufacturer’s instructions except that scale was increased 2 times ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using a MasterPure Yeast RNA purification kit (Biosearch Technologies, MPY03100). cDNA was synthesized using SuperScript™ III First-Strand Synthesis System (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... The coverslips with cells were immersed in 100µl hybridization buffer (90µl Stellaris RNA-FISH Hybridization Buffer (Biosearch Technologies, Cat. SMF-HB1-10) and 10µl deionized formamide (Millipore Sigma ...
-
bioRxiv - Systems Biology 2023Quote: ... each cover glass was set on a droplet (cells facing down) consisting of 45 μL hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 1 μL of the duplex smiFISH probes (MS2-transcript-binding probe mix + FLAP-Y-binding region annealed to FLAP-Y-Cy5 ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted by using MasterPure Yeast DNA purification kit (Biosearch Technologies, cat # MPY80200). The DNA samples were quantified and diluted ...
-
bioRxiv - Bioengineering 2023Quote: Genomic DNA was extracted using the MasterPure Yeast DNA Purification kit (LGC Biosearch Technologies) and quantified by NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated using the MasterPure Gram-Positive DNA purification Kit (Biosearch Technologies) with a modified protocol that included a bead-beating step [53] ...
-
bioRxiv - Neuroscience 2020Quote: ... Hybridization followed the manufacturer’s instructions (http://www.biosearchtech.com/stellarisprotocols) and was performed at 37°C for 16h in Stellaris RNA FISH hybridization buffer (Biosearch Technologies Cat# SMF-HB1-10) containing unc-8 probe at 1:100 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1-3 μL of HIV-1 RNA probe diluted in hybridization buffer (Stellaris RNA FISH Hybridization Buffer (Biosearch Tech. Cat# SMF-HB1-10)) and 10% formamide were spotted on coverslips and incubate overnight in humid conditions at 37C ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 ug of total RNA from cultured keratinocytes or fibroblasts was treated without (control) or with 10 units of RNase R in 10X RNase R reaction buffer (LGC Biosearch Technologies, Hoddesdon, UK). Treatment was conducted at 37°C for 12 minutes ...
-
bioRxiv - Genomics 2022Quote: ... the pooled PCR products were purified using sbeadex PCR clean-up kits (LGC, Biosearch Technologies) by following the manufacturer’s instructions to purify the PCR band at 286 bp ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted with MasterPure™ Complete DNA & RNA Purification Kit (MC89010, LGC Biosearch Technologies). Isolates were grown overnight on blood agar (PP0120-9090 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of the TdT-labeled probes was added to 98 μL of Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies Cat# SMF-HB1-10); 100 μL of this mixture was dotted onto the Parafilm in the humidifying chamber ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were incubated with 125 nM of each probeset (one for histone genes and second one for a control gene FOS in the Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies; SMF-HB1-10) overnight at 37°C in humified chamber ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mL deionized formamide) followed by 100 μL of freshly prepared Hybridization Buffer (90 μL Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies, SMF-HB1-10), 10 μL deionized formamide ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were re-fixed with 4% formaldehyde for 10 min and then hybridized with Stellaris RNA FISH probe for mouse Xist with Quasar 570 dye (BioSearch Tech, SMF-3011-1). First ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was extracted using the Masterpure Complete DNA Purification Kit (Lucigen-Biosearch Technologies, Middleton, WI, USA) and quantified on the QIAxpert® spectrophotometer (QIAGEN ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was extracted from EVs using the MasterPure Complete DNA and RNA Purification Kit (Biosearch Technologies). For comparison purposes ...
-
bioRxiv - Microbiology 2020Quote: ... Ethanol 70% is discarded and cells washed with 200 μL wash buffer A (10% vol./vol. formamide in 1X Wash Buffer A, Biosearch Technologies Cat# SMF-WA1-60). Cells were incubated with 100 μL Hybridization buffer containing 1,25 μM of RNA-FISH probes in the dark at 37 °C overnight (~16 hours) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated in a humidified chamber at 37 °C for 14 hours with probes diluted in Stellaris RNA FISH Hybridisation Buffer (LGC Biosearch Technologies; with 10% (v/v) formamide added ...
-
bioRxiv - Molecular Biology 2021Quote: ... Excess buffer was removed and 100 uL of freshly prepared Hybe Buffer Mixture was added (for two color in situs: 85.5 uL of Stellaris® RNA FISH Hybridization Buffer (Biosearch Technologies; Cat #: SMF-HB1-10); 9.5 uL deionized formamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 uL of freshly prepared Hybe Buffer Mixture was added (for two color in situs: 85.5 uL of Stellaris® RNA FISH Hybridization Buffer (Biosearch Technologies; Cat #: SMF-HB1-10); 9.5 uL deionized formamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were then washed once with 1000 uL of freshly prepared Stellaris® Buffer A Mixture (10% deionized formamide; 20% Stellaris® RNA FISH Wash Buffer A (Biosearch Technologies; Cat #: SMF-WA1-60); 70% RNase-free water) ...
-
bioRxiv - Plant Biology 2020Quote: ... Homogenised material was then treated following the Sbeadex® plant mini kit protocol (LGC Biosearch Technologies, Beverley, MA) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic DNA of the cells (5U OD) was extracted using MasterPure Yeast DNA Purification Kit (Biosearch Technologies) before and after two cycles of PCA selection (S2 and MTX2) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic DNA of the cells (5U OD) was extracted using MasterPure Yeast DNA Purification Kit (Biosearch Technologies) before and after two cycles of PCA selection (S2 and MTX2) ...
-
bioRxiv - Genetics 2024Quote: ... Genomic DNA was prepared from 0.5 ml of culture with the MasterPure Yeast DNA Purification kit (Biosearch Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Coverslips were subsequently submerged in wash buffer A (10% [v/v] de-ionised formamide, 20% [v/v] Stellaris wash buffer A [LGC Biosearch Technologies, Cat. No. SMF-WA1-60], 70% H2O) for 10–15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Pure lactobacilli isolates had their DNA extracted using MasterPure™ Gram Positive Purification Kit (LGC Biosearch Technologies, Hoddesdon, UK). All DNA extraction quantifications were performed with Qubit Fluorometer (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... ∼5x107 cells were collected and total RNA was extracted using a MasterPure Yeast RNA purification kit (Biosearch Technologies, MPY03100) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the RNA strands were transcribed in vitro at 37°C using 7.5% (v/v) T7 polymerase from the AmpliScribe T7-Flash transcription kit (ASF3507, Biosearch Technologies), 40mM of Tris-HCl ...
-
bioRxiv - Plant Biology 2023Quote: ... All DNA samples for KASP genotyping were extracted from young leaf tissue on an Oktopure DNA extraction system using sbeadex Plant DNA purification kits (Biosearch Technologies). KASP assays were designed and produced by Biosearch Technologies based on provided sequence data for six locations distributed across the region of low recombination on chromosome 5 ...
-
bioRxiv - Microbiology 2023Quote: ... Double-stranded oligonucleotides were then mixed in 1:1 ratios and prepared for blunt-end ligation using the End-It DNA End-Repair Kit according to the user manual (Biosearch Technologies). Ligation was performed overnight at 4 °C using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA of each isolate was extracted using the MasterPure™ Yeast DNA Purification Kit (LGC Biosearch Technologies, Halle-Zoersei, Belgium), according to the manufactureŕs protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from cells at exponential (Fig. 3C) or stationary (Fig. 1C) phase using the MasterPure Yeast RNA Purification Kit including a DNase treatment step (Biosearch Technologies), and converted to cDNA using random primers and the RevertAid Reverse Transcriptase kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was extracted from samples at the two timepoints of the PCA experiment using MasterPure Yeast DNA Purification Kit (Biosearch Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA for sequencing was extracted from exponential phase cultures of UT and UQ isolates using the MasterPure Gram Positive DNA Purification Kit (MGP04100; Biosearch Technologies) or Qiagen DNeasy Powersoil Pro Kit (47016 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We extracted genomic DNA from overnight YPD cultures derived from each clone according to the manufacturer’s instructions (MasterPure™ Yeast DNA Purification Kit, Biosearch Technologies - Lucigen, Wisconsin, USA) and purified on Axygen™ AxyPrep Magnetic PCR Clean-up SPRI beads (Axygen Inc ...