Labshake search
Citations for Biosearch Technologies :
51 - 100 of 145 citations for 5 NAPHTHALEN 1 YL 2H PYRAZOL 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... followed by a 5-minute wash in Wash buffer B (Biosearch Technologies, SMF-WB1-20). The coverslips were then mounted onto glass slides with Vectashield (VWR ...
-
bioRxiv - Immunology 2022Quote: ... Immunizations/infections were performed intraperitoneally (ip) with 100μg of 4-hydroxy-3-nitrophenylaceyl-keyhole limpet hemocyanine (NP-KLH) (Biosearch Technologies) adjuvanted with alum (Inject Alum ...
-
bioRxiv - Bioengineering 2022Quote: ... Methylene blue (MB) was attached to the 3’ terminus by conjugating the aptamer with a MB-NHS ester (Biosearch Technologies), followed by ethanol precipitation ...
-
bioRxiv - Immunology 2023Quote: ... animals were immunized by intrafootpad injection of 10μg of 4-hydroxy-3-nitrophenyl-acetyl (NP) hapten conjugated to the Keyhole limpet hemocyanin (NP-KLH) (Biosearch Technology) mixed with 10 µL of Imject™ Alum (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were then washed for 5 minutes with Wash Buffer B (Biosearch Technologies, SMF-WB1-20), before sections were mounted with VECTASHIELD® Hardset™ Antifade Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: Stellaris probe libraries targeting Chaserr introns or exons were designed using the Biosearch Technologies server (Supplementary Table 3) and ordered from Biosearch Technologies.
-
bioRxiv - Systems Biology 2020Quote: We designed oligonucleotide probe sets complementary to our genes of interest using custom probe design software written in MATLAB and ordered them with a primary amine group on the 3’ end from Biosearch technologies (see Supplementary Table 5 for probe sequences) ...
-
bioRxiv - Developmental Biology 2021Quote: ... then incubated overnight at 37°C in the dark with 50 nM of Quasar 570 labeled Stellaris probe against entire nos 3’UTR sequence (LGC Biosearch Technologies) in the Hybridization Buffer containing 2X SSC ...
-
bioRxiv - Systems Biology 2021Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3’ end from Biosearch Technologies (Supplementary Table 3 for probe sequences) ...
-
bioRxiv - Immunology 2022Quote: Wt and TNS3 nc/nc littermates (8–12 weeks old) were immunized by intraperitoneal injection with 200 μg of 4-Hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG, Biosearch Technology) in alum (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: Mice (aged 2–6 months) were injected intraperitoneally with 50 μg of 4-hydroxy-3-nitrophenylacetyl conjugated to chicken gamma globulin (NP-CGG) (Biosearch Technologies) in Imject Alum (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software in MATLAB and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (seeSupplementary Table 1 for probe sequences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Hybridization step occurred in a parafilm-sealed humidity chamber with cells incubated in 125 nM RNA FISH probes (Supplementary Table 3)-containing Stellaris Hybridization Buffer (Biosearch Tech) for 16 hrs at 37°C in the dark ...
-
bioRxiv - Bioengineering 2023Quote: ... We then ordered probes with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled all oligonucleotides and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Immunology 2024Quote: Six-to twelve-week-old mice were immunized with 25 g 4-Hydroxy-3-nitrophenylacetic hapten conjugated to AminoEthylCarboxyMethyl-Ficoll (NP-Ficoll, LGC Biosearch Technologies), 50 µg NP-CGG (Chicken Gamma Globulin ...
-
bioRxiv - Genomics 2023Quote: ... 1 mL of recovery media (Biosearch Technologies, 80026-1) was transferred to each culture tube in advance ...
-
bioRxiv - Immunology 2020Quote: Mice were immunized with 50μg of NP-KLH (4-hydroxy-3-nitrophenylacetyl-Keyhole Limpet Hemocyaninin; conjugation ratio 29-33, Biosearch technologies N-5060) dissolved in PBS at 2mg/mL and emulsified at a 1:1 ratio with Imject Alum Adjuvant (ThermoFisher Scientific 77161) ...
-
bioRxiv - Immunology 2020Quote: ... with 100 μg of NP-CGG (in average 16 molecules of NP, 4-hydroxy-3-nitrophenyl acetyl, conjugated to one molecule of CGG, chicken γ-globulin; Biosearch Technologies) in the presence of 100 μl of alum (Imject® Alum adjuvant ...
-
bioRxiv - Immunology 2023Quote: ... by one or two intraperitoneal (i.p.) injections of 100 µg of 4-hydroxy-3-nitrophenylacetyl hapten (NP) conjugated to ovalbumin (NP-ova, Biosearch Technologies, Novato, CA), emulsified in 100 µL Imject® alum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... The EZH2 probe set was ordered from the Stellaris Design Ready Probe Sets (Biosearch Technologies VSMF-2123-5). All other RNA-FISH probe sets were custom designed using the Stellaris Probe Designer tool at the biosearchtech.com website ...
-
bioRxiv - Cell Biology 2023Quote: ... eGFP transcripts were detected using the pre-designed Quasar 570 probe set (Biosearch Technologies Inc., VSMF-1014-5).
-
bioRxiv - Immunology 2022Quote: ... 10-to 18-week-old mice were injected intraperitoneally with 100 μg of alum-precipitated 4-hydroxy-3-nitrophenylacetyl (NP)-chicken-gamma-globulin (CCG) (Biosearch Technologies, Novato, CA) in 200 μl sterile PBS (Gibco) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eIF4E-5 mRNA were designed using the Stellaris® RNA FISH Probe Designer (Biosearch Technologies, Inc., Novato, USA) available online at www.biosearchtech.com/stellarisdesigner ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the female- and male specific splice forms of doublesex (dsxF/dsxM) and Abdominal B (AbdB) (Supp Table 3) using the Stellaris RNA FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA). dsxF mRNA was labeled with Quasar 570 ...
-
bioRxiv - Cell Biology 2020Quote: ... 10% deionized formamide for 5 min, and incubated with hybridization mix (0.1 μM RNA FISH, 10% deionized formamide, in Hybridization Buffer (Biosearch Technologies)) overnight at 37°C in the dark ...
-
bioRxiv - Bioengineering 2024Quote: Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
bioRxiv - Immunology 2024Quote: ... with a 1:1 mixture of 50 µg NP17-OVA ((Biosearch Technologies/BioCat) in PBS and Imject Alum (Thermo Fisher)) ...
-
bioRxiv - Genomics 2023Quote: ... 10 x 200 µL aliquots of extraction buffer (Dissociation Buffer, 1% Kollidon VA64, 1% Triton X100, 0.01% BSA, 666 units/mL RNase-inhibitor (Biosearch technologies, 30281-1)) were dispensed onto the puck for a total volume of 2 mL ...
-
bioRxiv - Bioengineering 2023Quote: ... we designed complementary oligonucleotide probe sets using custom probe design software (MATLAB) and ordered them with a primary amine group on the 3′ end from Biosearch Technologies (Table S2 for probe sequences). We then pooled each gene’s complementary oligos and coupled the set to Cy3 (GE Healthcare) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... respectively and a commercially available library of 48 probes was used to detect HOXA5 (cat # VSMF-2538-5) (Stellaris RNA FISH probes, Biosearch Technologies). Hybridization conditions and imaging were as previously described (Itzkovitz et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was incubated for 5 minutes and ACTB probe set was hybridized in for 16 hours at 37°C with Hybridization buffer (LGC Biosearch Technologies). After hybridization ...
-
bioRxiv - Neuroscience 2020Quote: ... Endogenous Cdc42 isoforms were detected with 5’ Cy5-labelled Stellaris probes to the exons 6 or 7 (probe sequences available upon request; BioSearch Tech.). Hybridization conditions for Stellaris probes for cultured neurons and for tissue sections was performed as recently described (Terenzio et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated overnight in the dark at 46 °C with 100 μl of hybridization buffer containing 5 ng/μl of the MicroB FISH probe conjugated to Cal Fluor 610 (LGC Biosearch Technologies). Samples were then washed in 1ml of wash buffer (Hybridization buffer + 5 mM EDTA) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated overnight at 46°C in 100 μl hybridization buffer containing 5-10 ng/μl of FISH probe conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). 5 ng/μl MicroB (ctctcggcactccttcctg)27 was used to detect N ...
-
bioRxiv - Immunology 2020Quote: T-cell dependent immune responses were induced by intraperitoneally injecting mice with NP-CGG (N-5055B-5, Biosearch Technologies, Novato CA), as follows ...
-
bioRxiv - Immunology 2020Quote: ... percentage of NP-binding B1-8hi cell were determined by staining a fraction of cells with 5 mg/mL NP(19)-PE (Biosearch Technologies) and analyzing by flow cytometry.
-
bioRxiv - Molecular Biology 2022Quote: ... and 0.01% SDS] and incubated overnight at 46°C in 100μl hybridization buffer containing FISH probe (5 to 10 ng/μl) conjugated to a Cal Fluor 610 dye (LGC Biosearch Technologies). Orsay Probe 1 (gacatatgtgatgccgagac ...
-
bioRxiv - Immunology 2023Quote: ... ICs were generated by coincubation of 10 μg/ml anti-TNP human IgG subclasses (clone 7B4) and 5 μg/ml BSA coupled with either an average of 4 or 33 TNP molecules (Biosearch Technologies) to mimic low or high valency ICs ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg/ml trinitrophenyl (TNP)-specific human IgG1-4 (clone 7B4) were incubated with 5 μg/ml TNP-conjugated BSA (TNP-33-BSA, BioSearch Technologies) in PBS for 3 hours gently shaking at 60 rpm ...
-
bioRxiv - Genetics 2024Quote: ... arrested cells were released into rich media containing 200 mM hydroxyurea and 130 μM Edu (5-Ethynyl-2’-deoxyuridine) (Biosearch Technologies). Cells were harvested in G1 and after 60 minutes release into HU ...
-
bioRxiv - Genomics 2024Quote: ... Purified ligations were electrotransformed by combining 5 µL of ligation and 25 µL of Endura electrocompetent cells (Biosearch Technologies 60242-2) in a 0.1 cm Gene Pulser cuvette (Biorad 1652083 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (BioSearch Technologies 60345-1), and overnight cultures were grown in LB supplemented with 25 µg/mL kanamycin ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 12.5uM Stellaris custom nascent Quasar 570 RNA FISH probes (targeting intronic regions of top SOX6 cluster genes Bcas1 or Nfasc) (Biosearch Technologies, SMF-1063-5) overnight in the dark at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris RNA-FISH probes labelled with Quasar 570 Dye for NEAT1_2 (SMF-2037-1) (1:100, Biosearch Technologies) were used according to the instructions provided ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ethanol was left to evaporate at room temperature for 5 min and slides were then washed with Stellaris RNA FISH Wash Buffer A (Biosearch Technologies Cat# SMF-WA1-60). 100 μL of hybridization solution (containing 10% dextran sulfate ...
-
bioRxiv - Genomics 2022Quote: ... labelled with FAM dye (1:100, Biosearch Technologies) were used and the procedure was carried out according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Cells were then incubated in 70% ethanol at 4°C for at least 1 h and then washed with 1 ml of Wash Buffer A (LGC Biosearch Technologies) at room temperature for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... Nitrophenyl-haptenated ovalbumin (NP-OVA, 25:1 ratio) or NP-MOG (25:1 ratio) were generated in house using NP-OSu (Biosearch Technologies Inc.) and either Ovalbumin protein (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... NP-PE (N-5070-1, Biosearch Technologies, Novato CA), CD138-BV650 (281-2 ...
-
bioRxiv - Genomics 2023Quote: ... 50 µl of RNase-inhibitor (Biosearch technologies, 30281-1)) which was added to nuclei suspension ...