Labshake search
Citations for abcam :
351 - 400 of 2435 citations for Recombinant Human TNFRSF17 protein Fc His tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... for immunoprecipitation with mouse anti-His tag monoclonal antibody (Abcam, USA) or rabbit anti-NEMO monoclonal antibody (Abcam ...
-
bioRxiv - Immunology 2020Quote: ... plate was incubated with anti-his antibody conjugated with HRP (abcam) for 2 h at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was synthesized using the Hi-Fi cDNA Synthesis Kit (Abcam). To reduce the potential for genomic DNA amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-6x(His) mAb was purchased from Abcam (Cambridge, UK), to detect NS1 protein expression ...
-
bioRxiv - Neuroscience 2023Quote: ... and digestion was confirmed using an anti-His tag antibody (Abcam). LRRC4B (ectodomain and fragments ...
-
bioRxiv - Biophysics 2024Quote: ... incubated with 0.1 µg/mL Anti-6X His tag antibody (abcam) in 2% BSA in TTBS for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... (Human Fibrinogen: ab208036 Abcam UK, Human Gelsolin: ITRP09965 Immunotag, USA, Human Apolipoprotein AIV: ab214567 Abcam UK ...
-
bioRxiv - Developmental Biology 2021Quote: ... HA-tagged SRY variants were immunoprecipitated with rabbit polyclonal anti-phosphoserine antiserum (Abcam). WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Plant Biology 2021Quote: ... Myc-tagged candidate interactors were detected using Goat α-Myc polyclonal antibodies (Abcam) in subsequent western blot analysis as described by (Tian et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Expression of Myc tagged LIN-39 was detected using anti-Myc (Abcam, #ab9106), expression of Flag-tagged UNC-3 in the total cell lysate was detected using mouse anti-Flag (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... HA-tagged SRY variants were immunoprecipitated with rabbit polyclonal anti-phosphoserine antiserum (Abcam). WB following 4-20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Systems Biology 2020Quote: ... Recombinant Anti-ENO1 antibody [EPR19758]: 1:1000 (ab227978, Abcam), GAPDH Monoclonal Antibody (6C5) ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant anti-Bcl-2 antibodies (AF647, Abcam, Berlin, Germany), Triton -X-100 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Recombinant Anti-ACE2 antibodies (Cat# ab108209; Abcam: N-terminal) and (Cat# ab15348 ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD133 (Recombinant Anti-CD133 antibody-EPR20980-104 #ab216323 abcam, Flow Cyt ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant anti-p27 KIP 1 antibody [Y236] (Abcam, ab32034) at 1:100 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant anti-beta actin antibody (Abcam,cat#ab115777) were incubated with the membrane overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... recombinant anti-GATA3 antibody [EPR16651] (ab199428, Abcam, 1:200), anti-acidic hair keratin K31 guinea pig polyclonal (GP-hHa1 ...
-
bioRxiv - Genetics 2023Quote: ... Recombinant Anti-AKT1 + AKT2 + AKT3 antibody [EPR16798] (Abcam, # AB179463), Recombinant Anti-AKT1 + AKT2 + AKT3 (phospho S472 + S473 + S474 ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant IKAROS (3 μL, 8 μM, ABCAM, ab169877-5), (+/-)-thalidomide (1 μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant anti-Ki67 primary antibody (1:200; Abcam; ab16667) was applied to each section and the peroxidase-conjugated 2-step enhancer-polymer system (DCS ...
-
bioRxiv - Developmental Biology 2023Quote: ... and primary recombinant anti-CDX2 antibody (Abcam, Melbourne, AUS) at 1:500 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant rat Sonic hedgehog (Shh) was purchased from Abcam. Stock solutions of PGE2 (1 μg/μl ...
-
Single-cell assessment of trophoblast stem cell-based organoids as human placenta-modeling platformsbioRxiv - Developmental Biology 2022Quote: ... and anti-HLA-G APC (clone MEMG-9; 1:150; Abcam). Cells were then washed in PBS and resuspended in FACS buffer (PBS supplemented with 2% FBS and 0.5 mM EDTA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and APC Anti-Rabbit IgG (H+L) Antibody (Abcam, ab130805,1:400) for 0.5 hour ...
-
bioRxiv - Immunology 2024Quote: ... followed by a goat anti-rabbit antibody conjugated with APC (Abcam). For the washing steps ...
-
bioRxiv - Genetics 2019Quote: ... The cells were fixed in 4% paraformaldehyde and permeabilized with saponin and lysosomes were labeled using 10 μg/mL dilution of FITC-labeled antibody against mouse Lamp-1 (ab24871, abcam), a lysosomal structural protein ...
-
bioRxiv - Immunology 2024Quote: ... followed by the goat Anti-Rabbit IgG Fc AF568 (Abcam) secondary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant antibody generated from the full-length SARS-CoV-2 nucleocapsid protein (product ab272852) and goat anti-human IgG (ab97225) conjugated with horseradish peroxidase (HRP) purchased from Abcam. Nickel coated clear 96-well plates were purchased from Thermo Scientific (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: Recombinant antibody generated from the full-length SARS-CoV-2 nucleocapsid protein (product ab272852) and anti-human secondary antibody were purchased from Abcam. Proteins were resolved on a 4-12% Bis-tris gel using SDS-PAGE and transferred to a PVDF membrane (pore size 0.45 µm) ...
-
bioRxiv - Cell Biology 2022Quote: ... The following commercial polyclonal and monoclonal antisera were used (m, mouse; h, human and r, rat proteins): anti-LIMPII (ab165222) was from Abcam; anti-Calnexin (2679) ...
-
bioRxiv - Bioengineering 2022Quote: ... and a cocktail of biotinylated detection antibody (~1 ng/ml per each protein panel) and phycoerythrin (PE, 532 nm emission) conjugated anti-human IgG antibody (10 ng/ml, Abcam) was loaded onto the barcoded array slide after removing excess serum using BSA solution ...
-
bioRxiv - Neuroscience 2022Quote: ... The expression of ACE2 Receptor protein (Rabbit Anti-Human Polyclonal, Citrate Buffer HIER, dilution 1:2000, Abcam, Code Number: ab15348) and TMPRSS-2 protein (Rabbit Anti-Human Monoclonal ...
-
bioRxiv - Plant Biology 2020Quote: ... and labeled with antibodies (Streptavidin HRP: ab7403 Abcam; lipoic acid ...
-
bioRxiv - Cell Biology 2019Quote: ... Fluorescently labeled (Alexa Fluor 488 or 647; Abcam) secondary antibodies were used according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... Alexa Fluor 647-labeled anti-KRT5 (ab193895, Abcam), rat-anti-Ki67 (14-5698-82 ...
-
bioRxiv - Immunology 2021Quote: ... was covalently labeled with PE-Cy7 (abcam, ab102903) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Rabbit IgG (Abcam, #ab131366); HRP-labeled Goat Anti-Mouse IgG (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Genetics 2023Quote: ... Cells were labeled with anti-TGN46 antibody (Abcam) and Alexa Fluor-conjugated secondary antibody (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit polyclonal anti-6X His tag antibody at 1:1000 (ab1187; Abcam). All secondary antibodies were used at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... for probing NEMO and mouse anti-His tag monoclonal antibody (Abcam, USA) for probing NS5A.
-
bioRxiv - Immunology 2020Quote: ... the wells was incubated with anti-his antibody conjugated with HRP (abcam) for 2 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... Rabbit Anti-6X His tag® antibody - ChIP Grade (Abcam, Cat #: ab9108).
-
bioRxiv - Systems Biology 2019Quote: ... Expression of the E-tagged PKC clones with anti-E-tag antibody (ab66152, Abcam) and un-tagged CARD14 was detected with anti-CARD14 (HPA023388 ...
-
bioRxiv - Cell Biology 2023Quote: ... Uip4 tagged with13xMyc epitope was detected by using α-myc (abcam ab56 (1:5000), ab9106 (1:10000)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human CD71 (Abcam), human CD235A (Abcam) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human CD235A (Abcam), human PDL1 (E1L3N ...
-
bioRxiv - Immunology 2020Quote: ... For selected experiments T cells were cultured in serum-depleted medium with or without native human C1q protein (100ug/ml, Abcam, ab96363).
-
bioRxiv - Genomics 2022Quote: ... Immunostaining was performed using a rabbit polyclonal to human SC lateral element protein SCP3 (1:500 dilution; Cat# ab15093, Abcam; RRID:AB_301639) and a Cy3-labeled donkey anti-rabbit IgG (H+L ...