Labshake search
Citations for abcam :
1 - 50 of 10000+ citations for Goat Anti Mouse IgG Fc Alkaline Phosphatase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Goat anti-Rabbit IgG H&L alkaline phosphatase (Abcam (ab97048)) 1/5000 ...
-
bioRxiv - Microbiology 2020Quote: ... IgG antibodies were measured with goat-anti-mouse secondary antibodies (1:4,000, alkaline phosphatase coupled, Abcam, USA) and substrate solution of p-nitrophenyl phosphate (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound antibody was removed by five 5-min washes and the membrane was incubated with alkaline phosphatase-conjugated goat anti-mouse secondary antibody or goat anti-human IgG secondary antibody (Abcam, Cambridge, UK). Membranes were washed again and then developed using SuperSignal ELISA Pico Chemiluminescent Substrate Kit (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and goat anti-rabbit–alkaline phosphatase antibody (Abcam) was added for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated for 1 h with goat anti-mouse IgG antibodies conjugated to alkaline phosphatase (Abcam Cat# ab97020) diluted 1:1000 in PBS ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-rabbit IgG alkaline phosphatase conjugate secondary antibody (Abcam) was diluted to 1:5000 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... alkaline phosphatase (AP) conjugated anti-human IgG (Abcam, Canbridge, UK), and p-nitrophenyl phosphate (PNPP ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-human placental alkaline phosphatase (Abcam, 1:50), goat anti-doublecortin (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Western blot signals were detected using 1:5000 dilutions of either goat anti-mouse or goat anti-rabbit secondary antibodies conjugated to alkaline phosphatase (Abcam) and CDP-Star chemiluminescence kit (Invitrogen ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and goat anti-rabbit IgG Fc (Abcam) were amine-coupled to CM3 chips and human and rabbit mAbs were captured to an average density of 320 ± 1.5 RU (s.e.m) ...
-
bioRxiv - Immunology 2020Quote: ... A polyclonal alkaline phosphatase-conjugated rabbit-anti-human IgG (Abcam®), diluted 1:2000 in 1 % BSA in PBS was added for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Anti-alkaline phosphatase (Abcam, ab354), Anti-osteocalcin (Abcam ...
-
bioRxiv - Immunology 2020Quote: ... and goat anti-Rabbit IgG Fc (Abcam, USA) was amine coupled to CM3 surface ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-rat IgG Fc 488 (ab97089 abcam), goat anti-mouse IgG Fc Alexa Fluor™ 680 (115625071 Jackson Immuno Research).
-
bioRxiv - Microbiology 2020Quote: ... IgG2b and IgG3 subsets were detected with goat-anti-mouse secondary antibodies (1:4,000, alkaline phosphatase coupled, Abcam, USA) and substrate solution of p-nitrophenyl phosphate ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
bioRxiv - Cancer Biology 2020Quote: ... donkey IgG H&L (alkaline phosphatase) pre-adsorbed antibody (Abcam) was used to detect primary antibodies and detected by the liquid fast-red substrate kit (abcam) ...
-
bioRxiv - Molecular Biology 2021Quote: ... an anti-GFP monoclonal antibody (mFX75 Wako; 1:2,000 dilution) and an alkaline phosphatase-conjugated anti-mouse IgG (ab97020 Abcam; 1:20,000 dilution) were used as primary and secondary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... HRP conjugated goat anti-human IgG Fc was from Abcam, Cambridge ...
-
bioRxiv - Immunology 2024Quote: ... followed by the goat Anti-Rabbit IgG Fc AF568 (Abcam) secondary antibody ...
-
bioRxiv - Cell Biology 2022Quote: ... dyLight488-labeled goat anti-rabbit IgG and Alexa488-labeled goat anti-mouse IgG (Abcam). The cells were mounted in mounting medium.
-
bioRxiv - Immunology 2021Quote: ... For detection of IgG subclasses all serum samples were diluted to 1 total IgG EU and incubated at 37 °C for 1 h prior to detection with Alkaline Phosphatase conjugated anti-mouse IgG subclass-specific secondary antibodies (Southern Biotech or Abcam) incubated for 1 h at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... CoMiX-Fc were detected with a goat anti-human IgG Fc HRP pAb (Abcam, #ab97225), whereas CoMiX-FHR4 molecules and VHH controls were detected with a mouse anti-His HRP-conjugated mAb (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... or HRP-conjugated goat anti-rabbit IgG Fc antibody (Abcam, ab98467) or HRP-conjugated goat anti-human multi-species IgG antibody (Southern Biotech ...
-
bioRxiv - Bioengineering 2021Quote: - goat anti-Mouse IgG (Cy3) (Abcam #ab97035) – 1:200;
-
bioRxiv - Molecular Biology 2022Quote: ... or Goat Anti-Mouse IgG HRP (Abcam, Catalog No ...
-
bioRxiv - Cancer Biology 2023Quote: ... Goat anti-Mouse IgG AF594 (Abcam, ab150120); Goat anti-Guinea Pig IgG (H+L ...
-
bioRxiv - Bioengineering 2023Quote: ... goat anti-Mouse IgG (Cy3) (Abcam #ab97035) – 1:200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 488 goat anti-mouse and anti-rabbit IgG (Abcam, Cat#ab150079 ...
-
bioRxiv - Immunology 2024Quote: ... 100 ng/well goat anti-human IgG Fc (Abcam, Cambridge, UK, #ab97221) or rabbit anti-His (Bethyl ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam) was diluted 1:10000 and HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... goat anti-mouse IgG (Abcam, 1:25,000 dilution). After three PBS-T + 0.3% BSA washes ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Immunology 2021Quote: ... and then incubated with peroxidase-conjugated goat anti-mouse IgG or goat anti-rat IgG (Abcam, Cambridge, UK) for 1 hr ...
-
bioRxiv - Cancer Biology 2021Quote: ... Goat anti-mouse IgG H&L (HRP) (Abcam, #6789).
-
bioRxiv - Cell Biology 2019Quote: ... Goat anti–mouse secondary antibody IgG-HRP (ab97051, Abcam) and anti–rabbit IgG-HRP (ab205719 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Goat anti-mouse IgG (Cy3 (Abcam ab97035, 1:500), Alexa Fluor 488 goat anti-chicken IgG (Invitrogen A11039 ...
-
bioRxiv - Microbiology 2019Quote: ... stained with FITC - goat anti-mouse IgG (ab6785, Abcam) for 1 h ...
-
bioRxiv - Genomics 2019Quote: ... goat anti-mouse IgG conjugated with DyLight488 (Abcam, ab98757), goat anti-rabbit IgG conjugated with Cy3 (Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2021Quote: ... goat anti-mouse IgG Alexa Fluor 488 (Abcam, #ab150113) and wheat germ agglutinin (WGA ...
-
bioRxiv - Immunology 2022Quote: ... goat anti-mouse IgG H&L conjugated HRP (Abcam), was incubated in plate at room temperature for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... Goat Anti-Mouse IgG H&L (HRP) (ab205719, Abcam), Goat Anti-Mouse IgG Alexa Fluor® 488 (GB25301 ...
-
bioRxiv - Plant Biology 2022Quote: ... goat anti-mouse IgG H&L (HRP) (ab205719, Abcam) was used at a dilution of 1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: ... A horseradish peroxidase-conjugated goat anti-mouse IgG (Abcam) was used as the secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... and IRDye 680RD goat anti-mouse IgG (Abcam #ab216776) are 1:1000 in blocking buffer with 0.2% Tween-20 ...
-
bioRxiv - Neuroscience 2024Quote: ... or Goat Anti-Mouse IgG H&L (HRP) (Abcam, ab205719 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Recombinant gene product was either detected with Goat anti-GFP conjugated to Alkaline Phosphatase (ab6661 Abcam, Cambridge, Massachusetts) at 1:5000 dilution or 1:5000 Rabbit Polyclonal anti-SARS-CoV2 RBD (Cat# 40592-T62 Sino Biological ...
-
bioRxiv - Microbiology 2021Quote: ... The commercial secondary antibodies goat anti-mouse IgG (ab6789) and goat anti-rabbit IgG (ab6721) were purchased from Abcam.