Labshake search
Citations for abcam :
1 - 50 of 10000+ citations for Acetylated Lysine Rabbit Polyclonal HRP labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and H3 acetylated lysine 27 (H3K27ac, Abcam, ab472). Immunoprecipitated DNA was washed ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Rabbit IgG (Abcam, #ab131366); HRP-labeled Goat Anti-Mouse IgG (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... The rabbit polyclonal antibody to methylated lysines (Abcam, catalog no. ab23366) was used for the detection of protein methylation levels (dilution 1:5000) ...
-
bioRxiv - Microbiology 2024Quote: ... HRP labeled goat anti-rabbit IgG (1:4000, Abcam) and rabbit anti-mouse IgG (1:4000 ...
-
bioRxiv - Cell Biology 2020Quote: ... lysine 9-acetylated histone H3 (H3K9ac) (Abcam, 1:5000 dilution), beta-myosin heavy chain (β-MHC ...
-
bioRxiv - Cell Biology 2021Quote: ... SOD2 acetylated on lysine 68 (SOD2acK68) (ab 137037, Abcam, 1/1000), ubiquitinylated proteins (BML-PW8810-0500 ...
-
bioRxiv - Immunology 2023Quote: ... and HRP-conjugated donkey anti-rabbit IgG polyclonal (Abcam, ab97085) antibodies were used for western blotting and immunocytochemistry ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-acetylated p53 (K382; Abcam), rabbit anti-p53 (Abcam) ...
-
bioRxiv - Plant Biology 2020Quote: ... and HRP-conjugated anti-mouse antibodies (rabbit polyclonal, 1/10000, Abcam). The blots were visualized with the Western Lightning Plus Enhanced Chemiluminescence kit (PerkinElmer ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit polyclonal anti-GST-HRP (ab3416) antibodies were obtained from Abcam. Mouse monoclonal anti-LRRK2 (clone N138/6 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies: HRP-labeled goat anti-rabbit IgG (H+L) (Abcam ab205718), 1:15000 ...
-
bioRxiv - Physiology 2023Quote: ... polyclonal goat anti-rabbit IgG (H & L) HRP (Abcam, #ab97040, 1:10000), or polyclonal goat anti-guinea pig IgG (H & L ...
-
bioRxiv - Biochemistry 2021Quote: ... and HRP-conjugated goat polyclonal antibody against rabbit IgG (H+L) (Abcam, ab205718).
-
bioRxiv - Biochemistry 2020Quote: ... with the secondary antibody goat polyclonal Anti-Rabbit IgG HRP (Abcam Cat#ab205718). ECL western blotting substrate (Thermo Fisher Cat#32106 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Microtubules were labeled using rabbit polyclonal anti-alpha tubulin antibody (ab18251; Abcam; dilution 1:600); and YAP was labeled using mouse monoclonal anti-YAP antibody (sc-271134 ...
-
bioRxiv - Microbiology 2021Quote: ... or with a rabbit polyclonal anti-human IgA alpha-chain labelled with HRP (Abcam) and TMB substrate (SIGMA) ...
-
bioRxiv - Immunology 2022Quote: ... or with a rabbit polyclonal anti-human IgA alpha-chain labelled with HRP (Abcam) and TMB substrate (SIGMA) ...
-
bioRxiv - Immunology 2020Quote: ... The secondary antibodies were goat polyclonal anti-rabbit IgG (HRP) (ab6721, Abcam, 1:5000) and goat polyclonal anti-mouse IgG (HRP ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit polyclonal (Abcam), rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an HRP-labeled secondary antibody (Abcam), according to the manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... rinsed with HBSS and labeled with rabbit polyclonal anti-Chlamydia trachomatis antibody (Abcam ab252762, Cambridge, MA, USA). Cells were then rinsed in 1x PBS and labeled with Alexa Fluor 488 anti-mouse (ThermoFisher #A28175 ...
-
bioRxiv - Microbiology 2021Quote: ... rinsed with HBSS and labeled with rabbit polyclonal anti-Chlamydia trachomatis antibody (Abcam ab252762, Cambridge, MA, USA). Cells were then rinsed in 1x PBS and labeled with Alexa Fluor 488 anti-mouse (ThermoFisher #A28175 ...
-
bioRxiv - Neuroscience 2023Quote: ... Secondary antibodies were goat polyclonal antibody to rabbit IgG labeled with 6-nm gold particles (Abcam ab41498), at a dilution of 1:20 in diluent buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba1 (goat polyclonal, Abcam, and rabbit polyclonal, Wako), mouse-LRRK2 (rabbit monoclonal (c41-2) ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCNA (rabbit polyclonal, Abcam, ab2426 ...
-
bioRxiv - Cell Biology 2020Quote: ... Ki67 (Abcam, rabbit polyclonal), and sarcomeric α-actinin (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... nucleolin (rabbit polyclonal; Abcam) 1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal (Abcam ab6046); western blot ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit polyclonal (Abcam ab48389); western blot ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... rabbit polyclonal (ab14206, Abcam) against SYCP3 protein and chicken polyclonal against SYCP1 protein (a gift from Sean M ...
-
bioRxiv - Developmental Biology 2020Quote: ... SPE-18 protein was detected by a 1:5000 dilution of rabbit anti-SPE-18 polyclonal antibody (YenZym) and HRP conjugated goat-anti rabbit IgG (Abcam #ab6721). MSP was detected by a 1:10000 dilution of mouse anti-MSP monoclonal antibody 4A5 (Kosinski et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... and labeled with antibodies (Streptavidin HRP: ab7403 Abcam; lipoic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was probed with the unconjugated parental antibody and an HRP conjugated goat polyclonal anti-rabbit IgG secondary antibody (ab6721; Abcam; Lot # GR34222167, Clone: polyclonal) and a band was observed just below 50 kDa ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was probed with the antibody and an HRP conjugated goat polyclonal anti-rabbit IgG secondary antibody (ab6721; Abcam; Lot # GR34222167, Clone: polyclonal) and a band was observed just above 10 kDa ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was probed with the antibody and an HRP conjugated goat polyclonal anti-rabbit IgG secondary antibody (ab6721; Abcam; Lot # GR34222167, Clone: polyclonal) and doublet bands were observed flanking 50 kDa ...
-
bioRxiv - Bioengineering 2024Quote: ... and horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG as detection antibody were purchased from Abcam (Cambridge, UK). Capture antigens PDIA6 (ab101048) ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit polyclonal anti-kinastrin (#ab122769) and rabbit polyclonal pH3-Ser10 (#ab5176) antibodies from Abcam; mouse monoclonal anti-SDHA (#459200) ...
-
bioRxiv - Molecular Biology 2019Quote: ... rabbit polyclonal anti-nucleoporin (Abcam, Cambridge ...
-
bioRxiv - Immunology 2022Quote: ... rabbit polyclonal anti-TNF (abcam 34674 for confocal imaging and imaging flow cytometry) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sox2 (rabbit polyclonal, ab75179, Abcam), Fibrillarin (rabbit polyclonal ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fibrillarin (rabbit polyclonal, ab5821, Abcam) and α-tubulin (mouse monoclonal ...
-
bioRxiv - Bioengineering 2021Quote: ... osteopontin rabbit polyclonal (ab8448, Abcam), osteocalcin rabbit polyclonal (ab93876)) ...
-
bioRxiv - Neuroscience 2021Quote: ... (1:500, rabbit polyclonal, Abcam), anti-GFAP #04-1062 (1:250 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tbr1 (rabbit polyclonal, ab31940, abcam), Olig2 (goat polyclonal ...
-
bioRxiv - Cancer Biology 2022Quote: ... rabbit polyclonal antiCyclinD1 (ab134175 Abcam), rabbit polyclonal SF3B1 (Cell Signaling) ...
-
bioRxiv - Cancer Biology 2020Quote: ... rabbit polyclonal anti-BubR1 (Abcam, ab172518 ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit polyclonal anti-H2B (Abcam), mouse monoclonal anti-Bap31 (Alexis Biochemicals) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and sortilin (rabbit polyclonal, Abcam), each diluted 1:100 in blocking solution ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... α-GFP rabbit polyclonal (Abcam, ab290) and α-GAPDH mouse monoclonal (Abcam ...