Labshake search
Citations for abcam :
251 - 300 of 1082 citations for WesternBright Quantum HRP Substrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and anti-sheep HRP Secondary antibody (#ab97125, Abcam).
-
bioRxiv - Microbiology 2021Quote: ... with goat anti-rabbit IgG HRP (Abcam, UK) (1:2,500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-mouse IgG HRP (1:5000 Abcam ab97046).
-
bioRxiv - Cancer Biology 2022Quote: ... and HRP-linked anti-mouse-IgG (Abcam, ab6820). The blotting signals were detected with a Clarity Western ECL substrate (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-conjugated mouse anti-human kappa (SB81a; Abcam) or lambda (JDC-12 ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Envision HRP kit was used (Ab93697; Abcam) with the aminoethyl carbazole (AEC ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Mouse HRP (ab97023 – Abcam, 1:5000 WB), anti-Rabbit HRP (ab97051 – Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-Histone H3 HRP 1:1000 (Abcam, #ab21054,) Anti-Hexokinase 1:10000 (Biorad ...
-
bioRxiv - Plant Biology 2022Quote: ... or ⍺-Streptavidin-HRP antibody (abcam catalog No. ab191338) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... beta-actin HRP conjugated antibody (Cat# ab49900, Abcam). HRP-conjugated secondary antibodies for rabbit and mouse IgG were obtained from Invitrogen (Cat# A16096 and A16066 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Rabbit HRP (ab97051 – Abcam, 1:5000 WB), anti-Mouse Alexa Fluor 594 (A11032 – Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... IgG1 heavy chain HRP (1:10,000, abcam ab97240), or IgG2c heavy chain HRP (1:10,000 ...
-
bioRxiv - Immunology 2023Quote: ... Goat anti-human IgGFc (HRP) preadsorbed (Abcam, ab98624). Polyhistidine-tagged human CTLA-4 (HIS-hCTLA-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Rabbit IgG (Abcam, #ab131366); HRP-labeled Goat Anti-Mouse IgG (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Cell Biology 2023Quote: ... or Goat anti-rabbit HRP (PN: ab97051, Abcam) at 1:5000 dilution in 5% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit β-Tubulin-HRP (Abcam, ab21058, 1/5000), and anti-rabbit-HRP rabbit IgG-HRP (Dako ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit β-Tubulin-HRP (Abcam, ab21058, 1/5000), mouse IgG-HRP (Dako ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit β-Tubulin-HRP (Abcam, ab21058, 1/5000), anti-rabbit IgG-HRP (Dako ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-rabbit IgG (ab6721, Abcam), HRP-conjugated goat anti-human IgG (AP309P ...
-
bioRxiv - Plant Biology 2023Quote: ... HRP anti-GFP (1:12000, AB6663, Abcam, UK), HRP anti-HA (1:12000 ...
-
bioRxiv - Plant Biology 2023Quote: ... HRP anti-HA (1:12000, AB173826, Abcam, UK), or HRP anti-FLAG (1:12000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant Protein G (HRP) (Abcam, #ab7460; 1:5000), Goat Anti-Rabbit IgG H&L (HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse ꞵ-actin HRP-linked (Abcam #ab49900) 1:50000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and anti-rabbit HRP (1:5000, Abcam, ab6721) antibodies for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... HRP Conjugation Kit-Lightning-Link□ (Cat.#. ab102890, Abcam) was used ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of anti-6xHis-HRP antibody (Abcam; ab1187) diluted 1:10000 in PBS was added to the plates and incubated 1hr at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of HRP-conjugated anti-6xHis (Abcam; 1187) diluted 1:5000 in blocking buffer was added to the plates and incubated at room temperature for 1hr ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 50uL of anti-6xHis-HRP antibody (Abcam; ab1187) diluted 1:10000 in PBS (pH 7.4 or pH 5.8 ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with HRP-conjugated streptavidin (abcam) diluted 1:10 000 in BSA blocking buffer for 40 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Pgk1-HRP (mouse, 1:5000, ab197960, Abcam). Alternatively ...
-
bioRxiv - Bioengineering 2024Quote: ... or α-rabbit HRP (ab6721, Abcam, Cambridge, UK) were used at a 1:3000 dilution in 1X Tris Buffered Saline with 1% Casein ...
-
bioRxiv - Immunology 2023Quote: ... incubated in HRP-conjugated αRat secondary antibody (Abcam) for 30 min at room temperature and detection was performed with a streptavidin-HRP system (Vector Labs ...
-
bioRxiv - Developmental Biology 2023Quote: ... HRP-conjugated goat α-rabbit IgG (Abcam #ab205718) or HRP- conjugated goat α-mouse IgG (Abcam #ab205719 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The following secondary antibodies were used: donkey anti-rabbit HRP 1:5000 (Amersham na934) or goat antimouse HRP 1:5000 (abcam ab97023). Membranes were finally washed in TBST and developed with SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... After washing 3 times with TBS-T the blots were incubated with HRP-conjugated secondary antibodies (goat-anti-mouse HRP (Abcam, ab6789); goat-anti-rabbit HRP (Abcam ...
-
bioRxiv - Immunology 2020Quote: ... the membrane was incubated for 1 hour at room temperature with HRP-conjugated anti-goat secondary Ab and HRP-conjugated anti-β-actin (ab197277, Abcam). The membrane was washed with PBS-T thrice before visualization with enhanced chemiluminescence via the super signal west femto maximum sensitivity substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... The substrate is from the BrdU Cell Proliferation ELISA Kit (Abcam) and the manufacturer’s instructions were subsequently followed ...
-
bioRxiv - Cancer Biology 2021Quote: ... and signals were detected by DAB substrate kit (Abcam, Cambridge, UK) followed by hematoxylin staining ...
-
bioRxiv - Biochemistry 2021Quote: ... and visualized using DAB Substrate Kit (ab64238, abcam, Abcam, Cambridge, UK). Tissue sections were revealed using 3,3’-diaminobenzidine (20 μl/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... and visualized using DAB Substrate Kit (ab64238, abcam, Abcam, Cambridge, UK). Tissue sections were revealed using 3,3’-diaminobenzidine (20 μl/ml ...
-
bioRxiv - Pathology 2023Quote: ... Staining was performed with a DAB substrate system (Abcam, no. ab64238) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and DAB Substrate Kit (ab64238) were purchased from Abcam (Cambridge, UK). Rabbit-anti-ING5 (10665-1-AP ...
-
bioRxiv - Microbiology 2021Quote: ... horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG and HRP-conjugated goat anti-mouse IgG were purchased from Abcam (Cambridge, MA, USA). Purified ZIKV-E protein from Escherichia coli was purchased from MyBioSource (San Diego ...
-
bioRxiv - Cancer Biology 2021Quote: ... Goat anti-mouse IgG H&L (HRP) (Abcam, #6789).
-
bioRxiv - Cell Biology 2020Quote: ... a particular HRP-conjugated secondary antibody (Abcam, Cat# ab131368) which preferentially detects the non-reduced form of mouse IgG over the reduced ...
-
bioRxiv - Cell Biology 2019Quote: ... Goat anti–mouse secondary antibody IgG-HRP (ab97051, Abcam) and anti–rabbit IgG-HRP (ab205719 ...
-
bioRxiv - Microbiology 2021Quote: ... and 1:1500 Goat anti-rabbit IgG-HRP (Abcam).
-
bioRxiv - Microbiology 2021Quote: ... then 1:1000 goat anti-rabbit IgG-HRP (Abcam); or 1:1000 13.3 anti-GAPDH (European Malaria Reagent Repository) ...