Labshake search
Citations for abcam :
2701 - 2750 of 10000+ citations for Mouse Anti SARS Coronavirus Nucleoprotein Antibody 3851 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... anti--Tubulin [DM1A] mouse (Abcam ab7291, 1:2000), and anti-Lamin B1 [EPR8985(B)] rabbit (Abcam ab133741 ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti GAPDH (Abcam, ab110305, RRID:AB_10861081, 1:1000), rabbit anti pParkin(Ser65 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Monoclonal mouse anti-beta-ACTIN (Abcam, catalogue #ab49900) antibody was used at 1:20000 dilution in 1% [w/v] dried milk supplemented PBST ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse anti-GABAA-R(1:500; ab94585, Abcam), and rabbit anti-c-Fos (1:1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Goat anti-mouse AF647 (ab150115, Abcam, 1:300), Goat anti-rabbit 568 (A-11011 ...
-
Cyborg islets: implanted flexible electronics reveal principles of human islet electrical maturationbioRxiv - Bioengineering 2024Quote: ... and Mouse anti-CD44 (ab6124, abcam, 1:250). Primary antibodies were incubated for 4 days at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-NPC from mouse (Ab24609, Abcam. 1:200), anti-Otefin from rabbit (custom made by Thermo Fisher Scientific 1:200) ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-mouse Desmin 1:200 (Abcam, ab15200), rat anti-mouse S1PR1 1:50 (R&D Systems ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-G3BP1 (mouse monoclonal, 1:500 dilution, Abcam), anti-FMRP (rabbit polyclonal ...
-
bioRxiv - Molecular Biology 2024Quote: ... goat anti-mouse DyLight®488 (Abcam, 96879) and goat anti-rat DyLight®594 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-FMRP (1:1000, Abcam, Cat.ab230915, RRID:AB_10950502), rabbit anti-pERK1/2 (1:1000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Donkey anti-mouse IgG AlexaFluor 405 (abcam, ab175658), Donkey anti-mouse IgG AlexaFluor 488 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-GFAP (abcam #ab190288; 1:1000). The following secondary antibodies were used ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey Anti-Mouse Alexa Fluor 555 (abcam # ab150106), Donkey Anti-Rabbit Alexa Fluor 647 (Thermo Fisher Scientific # A31573).
-
bioRxiv - Pathology 2024Quote: ... or anti-mouse CD3 (Abcam, dilution 1:100), respectively ...
-
bioRxiv - Pathology 2024Quote: ... a rabbit anti-mouse CitH3 (clone ab5103, Abcam), a mouse anti-human tissue factor (clone TF9-10H10 ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: monoclonal (mouse) anti-HA tag [12CA5] (Abcam, #ab1424), dilution 1:10000 ...
-
bioRxiv - Physiology 2024Quote: ... mouse monoclonal anti-cardiac troponin T (Abcam – ab8295), and wheat germ agglutinin (Invitrogen – W32466) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-SOX2 (AbCam: ab97959-100ug, 1:250) and Chicken anti-MAP2 (Abcam ab5392 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-lamin B2 (1:1000; Abcam, ab8983), rabbit anti-GAPDH (1:2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-mouse IgG (Abcam, Cat No. ab6820) coupled to horseradish peroxidase (1:10,000 dilution)
-
bioRxiv - Cell Biology 2024Quote: ... donkey anti-mouse IgG-Alexa Fluor 594 (Abcam), donkey anti-mouse IgG-Alexa Fluor 647 (Abcam) ...
-
bioRxiv - Cell Biology 2024Quote: ... donkey anti-mouse IgG-Alexa Fluor 647 (Abcam), donkey anti-rat IgG-Alexa Fluor 594 (Abcam) ...
-
bioRxiv - Microbiology 2023Quote: ... IRDye® 680RD Goat anti-mouse (abcam; ab216776) and IRDye® 800CW Goat anti-rabbit (abcam ...
-
bioRxiv - Microbiology 2024Quote: ... and rabbit anti-mouse IgG (1:4000, Abcam) were added and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... and mouse anti-H3K9me2 (ab1220, 1:100, Abcam). Rabbit anti-Vasa (1:1000 ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Streptavidin (1:500; Abcam S10D4, ab10020), rabbit anti-Streptavidin (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse polyclonal anti-PARG (ab169639) was from Abcam. Rabbit polyclonal anti-actin (20-33 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-α1 Na+/K+ ATPase (Abcam; ab7671), rabbit anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-P mouse (ab94965 – Abcam, 1:2000 WB), anti-G3BP1 rabbit (#61559 – Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... anti-N mouse (ab94806 – Abcam, 1:200 IF), anti-P mouse (ab94965 – Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-MTCO1 mouse IgG2a (Abcam, ab14705, 1:95), and anti-laminin (Sigma-Aldrich L9393 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... mouse anti-vimentin (clone RV202, Abcam # ab8978-1). The secondary antibodies used for Western blot detection were ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-TDP-43 (1:5000 Abcam ab104223) and rat ant-Tubulin (1:5000 Millipore MAB1864) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-XRCC1(Abcam, ab 1838; 1:50); mouse anti-γH2AX (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... or mouse anti-actin 1:10,000 (Abcam ab3280). Secondary HRP antibodies were purchased from Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α-tubulin (Abcam, ab7291, 1:300), rabbit anti-α-tubulin (Abcam,ab52866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-beta Actin (AC-15, ab6277, abcam), rabbit anti-Cnn2 (21073-1-AP ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-β-actin (Abcam, ab6276, 1:10,000), and mouse anti-Tpx2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse-anti-cFos (Abcam, ab208942, RRID:AB_2747772, 1:500), rabbit-anti-cFos (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a mouse anti-Sox2 (1/500 Abcam ab79351), a rabbit anti-Nestin (1/600 Sigma N5413 ...
-
bioRxiv - Genomics 2023Quote: ... mouse anti-p24 (diluted 1/2,000; abcam; ab9071), rabbit anti-SARS spike protein (diluted 1/2,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-NeuN mouse monoclonal (1:500; Abcam) for 24 h at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse-anti Tuj1 (1:400; #ab14545; Abcam, UK); Mouse-anti Map2 (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-rhodopsin dilution 1:400 (Abcam, 4D2), or rabbit anti-Zpr-1 dilution 1:400 (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse alpha muscle actin (Abcam, ab8211-500), Allophycocyanin (APC)-conjugated anti-CD11c (clone ...
-
bioRxiv - Bioengineering 2023Quote: ... donkey anti-mouse 568 (1:500, Abcam, ab175700), donkey anti-goat 647 (1:500 ...