Labshake search
Citations for abcam :
2451 - 2500 of 10000+ citations for Rabbit Anti Human IgG+IgM+IgA Alexa Fluor 750 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Anti-mouse secondary IgG-HRP antibody (abcam, 6823) was used at a dilution 1:5000 to detect SARS-CoV-2 Spike protein and anti-rabbit secondary IgG-HRP antibody (Kindle Biosciences ...
-
bioRxiv - Pathology 2021Quote: ... anti-mouse IgG-HRP (Abcam; ab97046, 1:5000), Dolichos Biflorus Agglutinin (DBA ...
-
bioRxiv - Microbiology 2020Quote: ... followed by anti-Mouse IgG-HRP (Abcam ab6823) and developed using KPL TrueBlue peroxidase substrate (Seracare ...
-
bioRxiv - Cell Biology 2021Quote: ... or an anti-IgG antibody from Abcam (ab171870). Primer sequences used are listed in Supplementary Table 3.
-
bioRxiv - Molecular Biology 2022Quote: ... anti-mouse IgG H&L (HRP) (ab27241, Abcam), Alexa Fluor 488 donkey anti-mouse (A21202 ...
-
bioRxiv - Immunology 2020Quote: ... Donkey anti-goat IgG AF488 (Abcam, Cambridge, UK) was diluted 1:200 in incubation buffer and 50 µl was added to each section ...
-
bioRxiv - Cell Biology 2021Quote: AlexaFluor647 anti-goat IgG (H+L) (Abcam, ab150135)
-
bioRxiv - Biophysics 2019Quote: ... Goat IgG (anti-digoxigenin) was purchased from Abcam. Goat anti-human IgG and rabbit anti-goat IgG were purchased from Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... anti-monkey IgG HRP secondary antibody (Abcam, # ab112767), anti-dog IgG HRP secondary antibody (Bioss ...
-
bioRxiv - Physiology 2021Quote: ... FITC-conjugated donkey anti goat IgG (ab6881; Abcam). After three washes with 1% BSA-PBS ...
-
bioRxiv - Cell Biology 2021Quote: AlexaFluor488 anti-mouse IgG (H+L) (Abcam, ab150177)
-
bioRxiv - Genetics 2021Quote: ... for NPC1 and anti-mouse IgG (Abcam, ab205719) for α-Tubulin for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-mouse IgG HRP (1:5000 Abcam ab97046).
-
bioRxiv - Neuroscience 2020Quote: ... and Cy3 goat anti-guinea pig IgG (Abcam, Cambridge ...
-
bioRxiv - Genetics 2022Quote: ... and anti-IgG (Abcam, Cat# ab46540, RRID: AB_2614925)) pre-bound to 30 uL of Protein G Magnetic Beads (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HRP-linked anti-mouse-IgG (Abcam, ab6820). The blotting signals were detected with a Clarity Western ECL substrate (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... and monoclonal mouse anti-GAPDH IgGs (#ab125247, Abcam). Primary antibodies were detected and quantified by Western blotting ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-goat IgG-AlexaFluor 594 (1,000 dilution, Abcam), anti-mouse IgG-AlexaFluor 647 (1:1,000 dilution ...
-
bioRxiv - Synthetic Biology 2022Quote: ... goat anti-mouse IgG (Abcam, 1:25,000 dilution). After three PBS-T + 0.3% BSA washes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Donkey anti-mouse IgG AlexaFluor 405 (abcam, ab175658), Donkey anti-mouse IgG AlexaFluor 488 (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-mouse IgG (Abcam, Cat No. ab6820) coupled to horseradish peroxidase (1:10,000 dilution)
-
bioRxiv - Evolutionary Biology 2023Quote: - Anti-Mouse IgG H&L antibody (abcam, ab46540): rabbit antibody that we used as a negative control for the CUT&Tag at 1:100 dilution.
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-rat IgG Fc 488 (ab97089 abcam), goat anti-mouse IgG Fc Alexa Fluor™ 680 (115625071 Jackson Immuno Research).
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse IgG (ab6728; 1:1,000; Abcam) secondary antibodies to the membrane for 1 h in the presence of 5% milk followed by four washes in TBS-T and developing with ECL substrate (1705061 ...
-
bioRxiv - Immunology 2024Quote: ... and polyclonal anti-C3c-FITC IgG (ab4212, Abcam) (1:300 final dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... or anti-collagen type I IgG (ab34710; Abcam) for 2 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... or anti-collagen type I IgG (ab34710; Abcam) for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... Secondary antibodies (AF488 goat anti-mouse IgG, Abcam catalog #ab150113 ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-fHbp Anti-RecA rabbit antibody (Abcam) was used at a dilution of 1:8000 ...
-
bioRxiv - Developmental Biology 2019Quote: ... rabbit anti-pMad (1: 200) and rabbit anti-GFP (1:10,000) from Abcam, guinea pig anti-Traffic jam (1:10,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-KIM-1 (ab47635) and rabbit anti-mouse p21 (ab188224) (abcam, USA); rabbit anti-GAPDH (G9545 ...
-
bioRxiv - Molecular Biology 2019Quote: ... rabbit anti-NFKBIA [E130] (ab32518) and rabbit anti-Beta-Tubulin (ab52901) from Abcam, anti-GAPDH [FL-335] (sc-25778 ...
-
bioRxiv - Cell Biology 2024Quote: ... # 700255), FAK(Anti-Rabbit, 1:1000; ) TOM20 (Anti-Rabbit, 1:1000; Abcam, ab186735), SOX-2 (Anti-Rabbit ...
-
bioRxiv - Genomics 2023Quote: ... rabbit anti-H3K27me3 antibody (diagenode C15410069) or rabbit anti-H3K9me3 antibody (abcam ab8898) combined with mouse anti-H3 antibody (active motif 39763) ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit anti-SLC22A3 antibody (#ab183071) and rabbit anti-β1AR (#ab3442) are from Abcam. Goat anti-β1AR antibody is from Everest Biotech (EB07133) ...
-
bioRxiv - Microbiology 2024Quote: ... Goat IgG anti-mouse IgG-horseradish peroxidase (HRP) conjugated were purchased from Abcam (Cambridge, UK). Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were then stained with a secondary Alexa Fluor 647 antibody (Abcam, ab150083, 1:2000). On the final wash ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibodies used were goat α-chicken Alexa Fluor 488 conjugate (1:500; Abcam ab150169), goat α-mouse Alexa Fluor 488 conjugate (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then incubated in secondary antibody (Alexa Fluor® 488, Abcam, #ab150077, 1:1000) 18 h at 4°C with agitation ...
-
bioRxiv - Pathology 2024Quote: ... and glucagon (ab92517, 1:2000, Alexa Fluor 488-conjugated secondary antibody ab150077, 1:1000, Abcam). Nuclei were visualized by DAPI (Fluoroshield ...
-
bioRxiv - Neuroscience 2024Quote: ... synaptophysin) were incubated in appropriate secondary antibodies conjugated with Alexa Fluor 488 (1:250, Abcam, Cat# ab150113 ...
-
bioRxiv - Neuroscience 2019Quote: ... in combination with protein-specific antibodies (rabbit anti-RapGEF4 from Invitrogen, 1:250; rabbit anti-bassoon from Enzo, 1:500; rabbit anti-beta-actin from Abcam, 1:1000). We used Duolink reagents (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... Subsequently membranes were incubated with primary antibodies (1:500 rabbit anti-LEDGF-PWWP [Abcam; ab177159], 1:1000 rabbit anti-MeCP2 [Cell Signaling Technology; 3456S], 1:1000 rabbit anti-GAPDH [Abcam; Ab9485] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5 IgM, 1:1000, Abcam, and rat anti-HA MAb 3F10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies (N-cadherin 1:2500, GAPDH 1:750 (Abcam ab9485)) were diluted in 5% BSA in 1X TBST with 0.02% NaN3 overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: C57BL/6 mice were either treated with 750 µg carmofur (Abcam) dissolved in 100 µl corn oil or with corn oil only (vehicle ...
-
bioRxiv - Cell Biology 2020Quote: ... Unbound primary antibody was removed the following day by washing in 0.2% Tween 20 in PBS and blastocysts incubated for 2 hr at RT with goat anti-rabbit Alexa-488 conjugated secondary antibodies (Abcam, ab150077). Following washing ...
-
bioRxiv - Developmental Biology 2020Quote: ... at 4 °C overnight followed by staining with a secondary goat-anti-rabbit antibody coupled with Alexa 568 (ab175471, Abcam, US).