Labshake search
Citations for abcam :
2301 - 2350 of 7467 citations for Mouse E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-FMRP (1:1000, Abcam, Cat.ab230915, RRID:AB_10950502), rabbit anti-pERK1/2 (1:1000 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Donkey anti-mouse IgG AlexaFluor 405 (abcam, ab175658), Donkey anti-mouse IgG AlexaFluor 488 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-GFAP (abcam #ab190288; 1:1000). The following secondary antibodies were used ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey Anti-Mouse Alexa Fluor 555 (abcam # ab150106), Donkey Anti-Rabbit Alexa Fluor 647 (Thermo Fisher Scientific # A31573).
-
bioRxiv - Pathology 2024Quote: ... or anti-mouse CD3 (Abcam, dilution 1:100), respectively ...
-
bioRxiv - Pathology 2024Quote: ... a rabbit anti-mouse CitH3 (clone ab5103, Abcam), a mouse anti-human tissue factor (clone TF9-10H10 ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: monoclonal (mouse) anti-HA tag [12CA5] (Abcam, #ab1424), dilution 1:10000 ...
-
bioRxiv - Physiology 2024Quote: ... mouse monoclonal anti-cardiac troponin T (Abcam – ab8295), and wheat germ agglutinin (Invitrogen – W32466) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Pgk1-HRP (mouse, 1:5000, ab197960, Abcam). Alternatively ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse anti-SOX2 (AbCam: ab97959-100ug, 1:250) and Chicken anti-MAP2 (Abcam ab5392 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-lamin B2 (1:1000; Abcam, ab8983), rabbit anti-GAPDH (1:2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-mouse IgG (Abcam, Cat No. ab6820) coupled to horseradish peroxidase (1:10,000 dilution)
-
bioRxiv - Cell Biology 2024Quote: ... donkey anti-mouse IgG-Alexa Fluor 594 (Abcam), donkey anti-mouse IgG-Alexa Fluor 647 (Abcam) ...
-
bioRxiv - Cell Biology 2024Quote: ... donkey anti-mouse IgG-Alexa Fluor 647 (Abcam), donkey anti-rat IgG-Alexa Fluor 594 (Abcam) ...
-
bioRxiv - Immunology 2024Quote: ... Secondary antibodies of and anti-mouse (Abcam, AB175473) and anti-rabbit (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... mouse anti-MOMP antibody (Abcam ab41193, 1:1000), rabbit anti-HctA antibody (kindly gifted by Ted Hackstadt ...
-
bioRxiv - Microbiology 2023Quote: ... IRDye® 680RD Goat anti-mouse (abcam; ab216776) and IRDye® 800CW Goat anti-rabbit (abcam ...
-
bioRxiv - Microbiology 2024Quote: ... and rabbit anti-mouse IgG (1:4000, Abcam) were added and incubated at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal to mouse Osterix/Sp7 (ab22552, Abcam), Goat polyclonal to mouse Periostin (AF2955 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mouse anti-H3K9me2 (ab1220, 1:100, Abcam). Rabbit anti-Vasa (1:1000 ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
Hallmark molecular and pathological features of POLG disease are recapitulated in cerebral organoidsbioRxiv - Cell Biology 2023Quote: ... β-tubulin III (TUJ1) (mouse, 1:1000; Abcam, #ab78078), Synaptophysin (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Streptavidin (1:500; Abcam S10D4, ab10020), rabbit anti-Streptavidin (1:200 ...
-
bioRxiv - Pathology 2023Quote: ... CD68 (1:200, mouse monoclonal, Abcam cat# ab955), NeuN (1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... and KRT10 (mouse, Abcam ab76318, dilution 1:800) were incubated for 1.5 hours at 37°C in a wet staining chamber ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse polyclonal anti-PARG (ab169639) was from Abcam. Rabbit polyclonal anti-actin (20-33 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-α1 Na+/K+ ATPase (Abcam; ab7671), rabbit anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibodies were mouse monoclonals obtained from Abcam, UK for the various viral proteins - B023 and RSV1C2 for N ...
-
bioRxiv - Microbiology 2023Quote: ... anti-P mouse (ab94965 – Abcam, 1:2000 WB), anti-G3BP1 rabbit (#61559 – Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... anti-N mouse (ab94806 – Abcam, 1:200 IF), anti-P mouse (ab94965 – Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-MTCO1 mouse IgG2a (Abcam, ab14705, 1:95), and anti-laminin (Sigma-Aldrich L9393 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... mouse anti-vimentin (clone RV202, Abcam # ab8978-1). The secondary antibodies used for Western blot detection were ...
-
bioRxiv - Physiology 2023Quote: ... or mouse monoclonal Ab to SDHB (Abcam, ab14714), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-G3BP mouse antibody (1:500, ab56574; Abcam), anti-m6A rabbit antibody (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-TDP-43 (1:5000 Abcam ab104223) and rat ant-Tubulin (1:5000 Millipore MAB1864) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-XRCC1(Abcam, ab 1838; 1:50); mouse anti-γH2AX (Millipore ...
-
bioRxiv - Evolutionary Biology 2023Quote: - Anti-Mouse IgG H&L antibody (abcam, ab46540): rabbit antibody that we used as a negative control for the CUT&Tag at 1:100 dilution.
-
bioRxiv - Molecular Biology 2023Quote: ... or mouse anti-actin 1:10,000 (Abcam ab3280). Secondary HRP antibodies were purchased from Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal (SV5-Pk1, Abcam #ab27671, 1:1000); anti-Flag ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α-tubulin (Abcam, ab7291, 1:300), rabbit anti-α-tubulin (Abcam,ab52866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-beta Actin (AC-15, ab6277, abcam), rabbit anti-Cnn2 (21073-1-AP ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-β-actin (Abcam, ab6276, 1:10,000), and mouse anti-Tpx2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse-anti-cFos (Abcam, ab208942, RRID:AB_2747772, 1:500), rabbit-anti-cFos (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a mouse anti-Sox2 (1/500 Abcam ab79351), a rabbit anti-Nestin (1/600 Sigma N5413 ...
-
bioRxiv - Neuroscience 2023Quote: ... GAPDH mouse monoclonal (Abcam Inc Cat# AB9484, RRID:AB_307274), Beta 3 tubulin rabbit polyclonal (BioLegend Cat# 802001 ...
-
bioRxiv - Genomics 2023Quote: ... mouse anti-p24 (diluted 1/2,000; abcam; ab9071), rabbit anti-SARS spike protein (diluted 1/2,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-NeuN mouse monoclonal (1:500; Abcam) for 24 h at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse-anti Tuj1 (1:400; #ab14545; Abcam, UK); Mouse-anti Map2 (1:200 ...