Labshake search
Citations for abcam :
1551 - 1600 of 4488 citations for PLGF Mouse HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... mouse anti-unphosphorylated RNA polymerase II (Abcam ab817), rabbit anti-GAF (gift from Giovanni Cavalli ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal anti-polymyxin B antibody (ab40014) (Abcam) was added at a dilution of 1:1000 for one hour followed by three washes with TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-phospho-Histone H3 (1:400, Abcam), mouse anti-SOX2 (1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... HRP-conjugated mouse anti-human kappa (SB81a; Abcam) or lambda (JDC-12 ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Envision HRP kit was used (Ab93697; Abcam) with the aminoethyl carbazole (AEC ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-TGN46 [1:500 dilution] (Abcam #50595). Cells were washed 3x in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... anti-mouse LA/C-C (131C3, ab8984, Abcam) anti-rabbit LA/C-rod (EP4520-16 ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse anti-CAMKII (1:100; Abcam, #ab22609) for excitatory neurons in P07 sections ...
-
bioRxiv - Neuroscience 2023Quote: ... or mouse anti-MAP2 (1:500, Abcam Ab11268). After washing 3 times for 10 minutes each in PBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Mouse HRP (ab97023 – Abcam, 1:5000 WB), anti-Rabbit HRP (ab97051 – Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-pSer129-α-synuclein (clone EP1536Y; Abcam), mouse anti-APP (clone 22C11 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-flotillin-1 (#ab133497, Abcam, AB _11156367), rabbit antiphospho-Ser845-GluA1 (1:2500 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-ß-III TUBULIN (1:300, mouse; Abcam), anti-FOXG1 (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse monoclonal (1:3000, Abcam Cat# ab89780, RRID:AB_2042411), anti-MOG ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-APC (CC1, 1:100, Abcam ab16794), rabbit anti-Olig2 (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse anti-alpha tubulin (Abcam, Catalog no. ab7291) and rabbit anti-gamma tubulin (Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antibodies against mouse Smarca4 (5 μg, Abcam 110641) were added to the nuclear extract and then incubated overnight at 4ºC with rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μg mouse anti-H3K27me3 (Abcam, ab6002) on chromatin from the Tollrm9/rm10 mutant ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-NeuN monoclonal mouse (1:1000; Abcam, ab104224), anti-Nestin polyclonal chicken (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Bassoon monoclonal mouse (1:1000; Abcam, ab82958), anti-β III Tubulin polyclonal rabbit (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-GAPDH [1:1,000 dilution] (Abcam #ab8245); rabbit anti-caveolin-2 [1:500 dilution] (Abcam #ab3417) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... goat anti-mouse IgG (Abcam, 1:25,000 dilution). After three PBS-T + 0.3% BSA washes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and mouse integrin β1 (1:400, AbCam, ab30394), overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-gamma-tubulin (AbCam ab44928, 1:500), mouse anti-FASCILLIN III (DSHB 7G10 ...
-
bioRxiv - Neuroscience 2022Quote: ... CD68 (Abcam, mouse anti-CD68, ab31630, 1:500) was used to determine the level of microglia phagocytosis ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse monoclonal α-Tubulin (abcam, ab7291, 1/800), rabbit monoclonal Iba1 (Wako ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Streptavidin (1:500; Abcam S10D4, ab10020), rabbit anti-Streptavidin (1:200 ...
-
bioRxiv - Pathology 2023Quote: ... CD68 (1:200, mouse monoclonal, Abcam cat# ab955), NeuN (1:1000 ...
-
bioRxiv - Pathology 2023Quote: ... and KRT10 (mouse, Abcam ab76318, dilution 1:800) were incubated for 1.5 hours at 37°C in a wet staining chamber ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse polyclonal anti-PARG (ab169639) was from Abcam. Rabbit polyclonal anti-actin (20-33 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-α1 Na+/K+ ATPase (Abcam; ab7671), rabbit anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibodies were mouse monoclonals obtained from Abcam, UK for the various viral proteins - B023 and RSV1C2 for N ...
-
bioRxiv - Microbiology 2023Quote: ... anti-P mouse (ab94965 – Abcam, 1:2000 WB), anti-G3BP1 rabbit (#61559 – Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... anti-N mouse (ab94806 – Abcam, 1:200 IF), anti-P mouse (ab94965 – Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-MTCO1 mouse IgG2a (Abcam, ab14705, 1:95), and anti-laminin (Sigma-Aldrich L9393 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... mouse anti-vimentin (clone RV202, Abcam # ab8978-1). The secondary antibodies used for Western blot detection were ...
-
bioRxiv - Physiology 2023Quote: ... or mouse monoclonal Ab to SDHB (Abcam, ab14714), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-G3BP mouse antibody (1:500, ab56574; Abcam), anti-m6A rabbit antibody (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-TDP-43 (1:5000 Abcam ab104223) and rat ant-Tubulin (1:5000 Millipore MAB1864) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-XRCC1(Abcam, ab 1838; 1:50); mouse anti-γH2AX (Millipore ...
-
bioRxiv - Evolutionary Biology 2023Quote: - Anti-Mouse IgG H&L antibody (abcam, ab46540): rabbit antibody that we used as a negative control for the CUT&Tag at 1:100 dilution.
-
bioRxiv - Molecular Biology 2023Quote: ... or mouse anti-actin 1:10,000 (Abcam ab3280). Secondary HRP antibodies were purchased from Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal (SV5-Pk1, Abcam #ab27671, 1:1000); anti-Flag ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α-tubulin (Abcam, ab7291, 1:300), rabbit anti-α-tubulin (Abcam,ab52866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-beta Actin (AC-15, ab6277, abcam), rabbit anti-Cnn2 (21073-1-AP ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-β-actin (Abcam, ab6276, 1:10,000), and mouse anti-Tpx2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse-anti-cFos (Abcam, ab208942, RRID:AB_2747772, 1:500), rabbit-anti-cFos (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a mouse anti-Sox2 (1/500 Abcam ab79351), a rabbit anti-Nestin (1/600 Sigma N5413 ...
-
bioRxiv - Neuroscience 2023Quote: ... GAPDH mouse monoclonal (Abcam Inc Cat# AB9484, RRID:AB_307274), Beta 3 tubulin rabbit polyclonal (BioLegend Cat# 802001 ...