Labshake search
Citations for abcam :
1551 - 1600 of 10000+ citations for Mouse Anti Human Papilloma virus types 16 18 716 281 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-PCNT (ab28144, Abcam; 1:1000), rabbit polyclonal anti-CP110 (A301-343A ...
-
bioRxiv - Immunology 2022Quote: ... Armenian Hamster anti mouse CD31 (1:200, Abcam); rat anti Siglec-F (1:100 ...
-
bioRxiv - Genomics 2022Quote: ... mouse anti-unphosphorylated RNA polymerase II (Abcam ab817), rabbit anti-GAF (gift from Giovanni Cavalli ...
-
bioRxiv - Microbiology 2022Quote: ... mouse monoclonal anti-polymyxin B antibody (ab40014) (Abcam) was added at a dilution of 1:1000 for one hour followed by three washes with TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-phospho-Histone H3 (1:400, Abcam), mouse anti-SOX2 (1:400 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-TGN46 [1:500 dilution] (Abcam #50595). Cells were washed 3x in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... anti-mouse LA/C-C (131C3, ab8984, Abcam) anti-rabbit LA/C-rod (EP4520-16 ...
-
bioRxiv - Neuroscience 2023Quote: ... and mouse anti-CAMKII (1:100; Abcam, #ab22609) for excitatory neurons in P07 sections ...
-
bioRxiv - Neuroscience 2023Quote: ... or mouse anti-MAP2 (1:500, Abcam Ab11268). After washing 3 times for 10 minutes each in PBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Mouse HRP (ab97023 – Abcam, 1:5000 WB), anti-Rabbit HRP (ab97051 – Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-pSer129-α-synuclein (clone EP1536Y; Abcam), mouse anti-APP (clone 22C11 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-flotillin-1 (#ab133497, Abcam, AB _11156367), rabbit antiphospho-Ser845-GluA1 (1:2500 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-ß-III TUBULIN (1:300, mouse; Abcam), anti-FOXG1 (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-APC (CC1, 1:100, Abcam ab16794), rabbit anti-Olig2 (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse anti-alpha tubulin (Abcam, Catalog no. ab7291) and rabbit anti-gamma tubulin (Abcam ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μg mouse anti-H3K27me3 (Abcam, ab6002) on chromatin from the Tollrm9/rm10 mutant ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-NeuN monoclonal mouse (1:1000; Abcam, ab104224), anti-Nestin polyclonal chicken (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Bassoon monoclonal mouse (1:1000; Abcam, ab82958), anti-β III Tubulin polyclonal rabbit (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-GAPDH [1:1,000 dilution] (Abcam #ab8245); rabbit anti-caveolin-2 [1:500 dilution] (Abcam #ab3417) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... goat anti-mouse IgG (Abcam, 1:25,000 dilution). After three PBS-T + 0.3% BSA washes ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-gamma-tubulin (AbCam ab44928, 1:500), mouse anti-FASCILLIN III (DSHB 7G10 ...
-
bioRxiv - Neuroscience 2022Quote: ... CD68 (Abcam, mouse anti-CD68, ab31630, 1:500) was used to determine the level of microglia phagocytosis ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-MTCO1 mouse IgG2a (Abcam, ab14705, 1:95), and anti-laminin (Sigma-Aldrich L9393 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... mouse anti-vimentin (clone RV202, Abcam # ab8978-1). The secondary antibodies used for Western blot detection were ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-G3BP mouse antibody (1:500, ab56574; Abcam), anti-m6A rabbit antibody (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-TDP-43 (1:5000 Abcam ab104223) and rat ant-Tubulin (1:5000 Millipore MAB1864) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-Streptavidin (1:500; Abcam S10D4, ab10020), rabbit anti-Streptavidin (1:200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse polyclonal anti-PARG (ab169639) was from Abcam. Rabbit polyclonal anti-actin (20-33 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-α1 Na+/K+ ATPase (Abcam; ab7671), rabbit anti-α-tubulin (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-P mouse (ab94965 – Abcam, 1:2000 WB), anti-G3BP1 rabbit (#61559 – Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... anti-N mouse (ab94806 – Abcam, 1:200 IF), anti-P mouse (ab94965 – Abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... or mouse anti-actin 1:10,000 (Abcam ab3280). Secondary HRP antibodies were purchased from Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse-anti Tuj1 (1:400; #ab14545; Abcam, UK); Mouse-anti Map2 (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-rhodopsin dilution 1:400 (Abcam, 4D2), or rabbit anti-Zpr-1 dilution 1:400 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a mouse anti-Sox2 (1/500 Abcam ab79351), a rabbit anti-Nestin (1/600 Sigma N5413 ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-NeuN mouse monoclonal (1:500; Abcam) for 24 h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α-tubulin (Abcam, ab7291, 1:300), rabbit anti-α-tubulin (Abcam,ab52866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-beta Actin (AC-15, ab6277, abcam), rabbit anti-Cnn2 (21073-1-AP ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-β-actin (Abcam, ab6276, 1:10,000), and mouse anti-Tpx2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse-anti-cFos (Abcam, ab208942, RRID:AB_2747772, 1:500), rabbit-anti-cFos (Abcam ...
-
bioRxiv - Genomics 2023Quote: ... mouse anti-p24 (diluted 1/2,000; abcam; ab9071), rabbit anti-SARS spike protein (diluted 1/2,000 ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse alpha muscle actin (Abcam, ab8211-500), Allophycocyanin (APC)-conjugated anti-CD11c (clone ...
-
bioRxiv - Bioengineering 2023Quote: ... and mouse anti-β-actin (Abcam, Waltham, MA).
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A secondary rabbit anti-mouse antibody (ab6709, Abcam) binding step was carried out according to the same procedure if the host species of the primary antibody was mouse ...
-
bioRxiv - Genetics 2023Quote: ... mouse anti-fibrillarin (ab4566, Abcam; 1:50 dilution), human anti-centromere (441-10BK-50 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-tubulin bIII (1:1000, Abcam, #ab7751), goat anti-GFP (1:500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse anti-β1-integrin was obtained from Abcam. Alexafluor-conjugated secondary antibodies (488 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-active integrin-β1 (12G10; abcam, ab30394), rabbit anti-NM-IIA (BioLegend ...