Labshake search
Citations for abcam :
1201 - 1250 of 10000+ citations for Mouse anti Measles virus 6015 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-rhodopsin dilution 1:400 (Abcam, 4D2), or rabbit anti-Zpr-1 dilution 1:400 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a mouse anti-Sox2 (1/500 Abcam ab79351), a rabbit anti-Nestin (1/600 Sigma N5413 ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-labeled Goat Anti-Mouse IgG (Abcam, #ab131368). The primers GFP-forward (CGAAGGCTACGTCCAGGAGC ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-NeuN mouse monoclonal (1:500; Abcam) for 24 h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α-tubulin (Abcam, ab7291, 1:300), rabbit anti-α-tubulin (Abcam,ab52866 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-beta Actin (AC-15, ab6277, abcam), rabbit anti-Cnn2 (21073-1-AP ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-β-actin (Abcam, ab6276, 1:10,000), and mouse anti-Tpx2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse-anti-cFos (Abcam, ab208942, RRID:AB_2747772, 1:500), rabbit-anti-cFos (Abcam ...
-
bioRxiv - Genomics 2023Quote: ... mouse anti-p24 (diluted 1/2,000; abcam; ab9071), rabbit anti-SARS spike protein (diluted 1/2,000 ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse alpha muscle actin (Abcam, ab8211-500), Allophycocyanin (APC)-conjugated anti-CD11c (clone ...
-
bioRxiv - Bioengineering 2023Quote: ... and mouse anti-β-actin (Abcam, Waltham, MA).
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-mouse IgG (ab6789, Abcam), HRP-conjugated goat anti-rabbit IgG (ab6721 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A secondary rabbit anti-mouse antibody (ab6709, Abcam) binding step was carried out according to the same procedure if the host species of the primary antibody was mouse ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rabbit anti-human/mouse Runx1 (Abcam, ab92336). Secondary biotinylated antibodies were ...
-
bioRxiv - Genetics 2023Quote: ... mouse anti-fibrillarin (ab4566, Abcam; 1:50 dilution), human anti-centromere (441-10BK-50 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-tubulin bIII (1:1000, Abcam, #ab7751), goat anti-GFP (1:500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse anti-β1-integrin was obtained from Abcam. Alexafluor-conjugated secondary antibodies (488 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-active integrin-β1 (12G10; abcam, ab30394), rabbit anti-NM-IIA (BioLegend ...
-
bioRxiv - Neuroscience 2023Quote: ... and Mouse-anti GABA (abcam, ab86186, 1:400) in the blocking solution overnight at 4□C ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mouse anti-SMARCAD1 (1:500; ab67548, Abcam)].
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-cyclin A2 (Abcam, ab38, 1:500), mouse anti-vinculin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse-anti-bassoon (Abcam, Germany, dilution 1:300), mouse-anti-CtBP2 (BD Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-MT-CO1 (1:2000, 14705, Abcam), rabbit anti-COXIV (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... mouse anti-beta-actin (1:10000, Abcam, #ab3013), and rabbit anti-PCNA (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-NF200 (1:1000, mouse monoclonal, Abcam) or anti-PSD95 (1:500 ...
-
bioRxiv - Bioengineering 2023Quote: ... donkey anti-mouse 568 (1:500, Abcam, ab175700), donkey anti-goat 647 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-XRCC1(Abcam, ab 1838; 1:50); mouse anti-γH2AX (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-S100a10 (1:500; Abcam, Cat. ab232524) at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Goat anti-Mouse Alexa Fluor 568 (Abcam, Ab175473), Mouse IgG2a kappa Isotype Control (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... mouse anti-cMYC (clone 9E10 Abcam; 1:200), mouse anti-Gmc2 (raised against purified Gmc2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-beta III Tubulin (mouse, 1:1000, Abcam, Cat ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
Mitochondrial Apolipoprotein MIC26 is a metabolic rheostat regulating central cellular fuel pathwaysbioRxiv - Cell Biology 2023Quote: ... Goat IgG anti-Mouse IgG (Abcam, 1:10000) and Goat IgG anti-Rabbit IgG (Dianova ...
-
bioRxiv - Cancer Biology 2023Quote: ... and mouse anti-LaminB1 (0.5ug/ml, ab8982, Abcam) at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and mouse anti-H3K9me2 (ab1220, 1:100, Abcam). Rabbit anti-Vasa (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-NeuN (Abcam, Cat# ab104224, 1:1000), mouse anti-Neurofilament (Biolegend ...
-
bioRxiv - Evolutionary Biology 2023Quote: - Anti-Mouse IgG H&L antibody (abcam, ab46540): rabbit antibody that we used as a negative control for the CUT&Tag at 1:100 dilution.
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse anti-γH2AX (IF, 1:1000, Abcam ab26350), Guinea pig anti-H1t (IF ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-lamin B2 (1:1000; Abcam, ab8983), rabbit anti-GAPDH (1:2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-mouse IgG (Abcam, Cat No. ab6820) coupled to horseradish peroxidase (1:10,000 dilution)
-
bioRxiv - Immunology 2024Quote: ... Secondary antibodies of and anti-mouse (Abcam, AB175473) and anti-rabbit (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-phospho-(T210)-Plk1 (1:200, abcam), rabbit-anti-phospho(T288)-AURKA (1:100 ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: monoclonal (mouse) anti-HA tag [12CA5] (Abcam, #ab1424), dilution 1:10000 ...
-
bioRxiv - Physiology 2024Quote: ... mouse monoclonal anti-cardiac troponin T (Abcam – ab8295), and wheat germ agglutinin (Invitrogen – W32466) ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-GFAP (abcam #ab190288; 1:1000). The following secondary antibodies were used ...
-
bioRxiv - Neuroscience 2024Quote: ... Donkey Anti-Mouse Alexa Fluor 555 (abcam # ab150106), Donkey Anti-Rabbit Alexa Fluor 647 (Thermo Fisher Scientific # A31573).
-
bioRxiv - Synthetic Biology 2024Quote: ... Donkey anti-mouse IgG AlexaFluor 405 (abcam, ab175658), Donkey anti-mouse IgG AlexaFluor 488 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-FMRP (1:1000, Abcam, Cat.ab230915, RRID:AB_10950502), rabbit anti-pERK1/2 (1:1000 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1:2000 for anti-TBP (ab818, Abcam, mouse), 1:500 for anti-Lamin A/C (14-9688-80 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse ꞵ-actin HRP-linked (Abcam #ab49900) 1:50000 ...