Labshake search
Citations for Charles River Labs :
301 - 350 of 353 citations for Zika Virus NS1 Protein Suriname Strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... a CF clinical strain) or empty beads (as sham control) in 20-22g C57BL6/NCrl male mice (8-10 weeks, Charles River). Agar beads were produced by refining a previously described protocol [12 ...
-
bioRxiv - Neuroscience 2019Quote: ... we dissected hippocampi or cortices from postnatal day 0-1 rat pups of either sex (Sprague-Dawley strain; Charles River Laboratories), dissociated them with papain (Sigma ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The C57BL/6J inbred strain (30 male and 30 female) was purchased at the age of 3 weeks from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... All wild-type mice used as intruders in resident–intruder assays and for behavioral experiments were of the BALB/cAnNCrl or Crl:CD1 (ICR) strain (Charles River Laboratories). Health status was normal for all animals ...
-
bioRxiv - Cancer Biology 2021Quote: At > 6 weeks of age, Rag2-/- Il2rg-/- (bred in-house, Balb/c background strain) or Balb/c (Charles River Laboratories, UK) mice were anaesthetised (2% isoflurane in oxygen (2 l/min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Two-month-old male and female Crl:CD1-Foxn1nu/nu (CD-1 nude) mice (Strain Code 086, Charles River, Wilmington, MA, USA) were used for iCCA orthotopic transplantation and tail vein injection ...
-
bioRxiv - Neuroscience 2020Quote: ... Stimulus mice for social interaction were littermates (male VIP-Cre) or novel (age matched male CD-1 IGS, strain code: 022, Charles River Laboratories ...
-
bioRxiv - Immunology 2022Quote: We infected mice intranasally with 30 μl of PBS containing either 1 x 103 EID50 of the Influenza A X31 strain (Charles River) or 1 x 105 PFU of Influenza A X31-OVA (kindly provided by Dr ...
-
bioRxiv - Neuroscience 2023Quote: Experiments were conducted on adult Nrxn1α KO rats and wildtype littermates (strain: Sprague Dawley (SD)-Nrxn1
bred by Charles River, France ... -
bioRxiv - Developmental Biology 2023Quote: The following two species were used in this study: wildtype mice (Charles River; CD-1® IGS mouse, strain code 022), and wildtype rats (Charles River ...
-
bioRxiv - Cell Biology 2023Quote: ... coisogenic immunodeficient mice and human umbilical cord blood-derived CD34+ humanized coisogenic NOD-Prkdcem26Cd52Il2rgem26Cd22/NjuCrl female mice (huNCG, strain code: 695) mice were obtained from Charles River Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... we used the transgenic GFP P.berghei parasites (ANKA 2.34 strain) kept by serial passages into 3-4 weeks old female BALB/c mice (Charles River, Wilmington, MA) starting from frozen stocks ...
-
bioRxiv - Cell Biology 2021Quote: Murine submandibular salivary glands were dissected as previously described 57 from embryos harvested from timed-pregnant female mice (CD-1 strain, Charles River Laboratories) at E14 ...
-
bioRxiv - Physiology 2019Quote: ... were generated in-house by crossing C3H/HeOuJ females with C57BL/6 N males (strain codes 626 and 027, respectively, Charles River Laboratories). Experimental animals were generated in three breeding batches with 300 ...
-
bioRxiv - Immunology 2022Quote: ... those embryos at the 2-cell stage were implanted into the oviducts of pseudo-pregnant surrogate mothers (CD1 strain from Charles River Laboratory). Offspring were genotyped by PCR (Table 5) ...
-
bioRxiv - Genetics 2022Quote: ... were generated in-house by crossing C3H/HeOuJ females with C57BL/6NCrl males (strain codes 626 and 027, respectively, Charles River Laboratories). Animals were housed in groups of five females in individually ventilated cages under specific-pathogen-free conditions with constant temperature (21□°C) ...
-
bioRxiv - Neuroscience 2022Quote: ... All rats in this study were bred on a Sprague-Dawley background (Crl:CD-IGS background, strain Code 001, Charles River Laboratories, Inc.). Paternally- inherited Magel2 heterozygous rats (Magel2m+/p- ...
-
bioRxiv - Genomics 2022Quote: ... were generated in-house by crossing C3H/HeOuJ females with C57BL/6 NCrl males (strain codes 626 and 027, respectively, Charles River Laboratories). The DR study involving live mice was performed in accordance with the recommendations and guideline of the Federation of the European Laboratory Animal Science Association (FELASA ...
-
bioRxiv - Bioengineering 2023Quote: The system was tested on white (or albino) hairy mice of the B6 and BALB/c strains (Charles River Laboratories Japan, Japan). Experiments on healthy mice were performed using 9-week-old female mice ...
-
bioRxiv - Biochemistry 2023Quote: Cortical neuron cultures were established from neonatal mouse brains (wild-type C57BL/6, Charles River, strain code 027, or the genotype(s) indicated for each experiment ...
-
bioRxiv - Cancer Biology 2022Quote: Orthotopic syngeneic allografts were generated by intraperitoneal injection of one million of the murine cells KPC luc2 into 6-week-old female C57BL/6 mice (immunocompetent strain, SOPF health status, Charles River, France). Tumoral growth was followed by bioluminescence upon injection of 3 mg luciferin-EF (Promega ...
-
bioRxiv - Systems Biology 2023Quote: ... The primary neurons used in this investigation are derived from embryonic litters from pregnant CD-1 mice (Charles River Laboratories, strain 022). Two pregnant mice (gestational day 17 ...
-
bioRxiv - Biochemistry 2023Quote: Animals: Wild-type rats and mice used for the experiments were of the Sprague-Dawley strain (Charles River code 400, RRID: RGD_734476), and CD1 backgrounds respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... wild-type CD-1 mice of both sexes from age 7-60 days were used (CD-1 IGS; Charles River; strain code: 022). For in situ hybridization ...
-
bioRxiv - Developmental Biology 2022Quote: ... post-ganglionic NBPIs were surgically created in P5 wildtype female and male mice (Charles River; CD-1® IGS mouse, strain code 022) by extraforaminal nerve root excision under isoflurane anesthesia ...
-
bioRxiv - Molecular Biology 2021Quote: The immunogenicity of RBD-L452K-F490W in combination with various adjuvants was evaluated in 7-8 week-old C57BL/6J female mice (Charles River, strain: 000634) at the Vaccine Formulation Institute (VFI ...
-
bioRxiv - Molecular Biology 2021Quote: ... MKN45-hnRNP-MKO or double KO cells were injected into the flank of 8-10-week-old NOD-SCID (NOD.CB17-Prkdcscid/J, Charles River, Strain code: 634). Groups of 11 mice were used per cell type ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were performed in adult female C57B6L/6 mice (2 to 3 months of age, 20 to 25.1 g) (Charles River, Strain code:027). All procedures were performed under general anesthesia (20 mg/kg ketamine ...
-
bioRxiv - Developmental Biology 2023Quote: Immunodeficient NIH-III Nude mice (Crl:NIH-Lystbg-JFoxn1nuBtkxid) for skin patch transplantation and kidney capsule transplantation were purchased from Charles River (Strain Code 201). All mouse work was approved by the Institutional Animal Care and Use Committee (IACUC ...
-
bioRxiv - Neuroscience 2019Quote: Acute brainstem slices were prepared from postnatal day 5 (P5) to P24 mice pups of either sex (C57BL/6J strain; Charles River Laboratories, Wilmington, MA). After decapitation ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Cohorts of specific pathogen free (SPF, according to FELASAs exclusion list) male and female C57BL/6 mice were purchased from Charles River (strain C57BL/6J), Germany ...
-
bioRxiv - Bioengineering 2022Quote: ... Mouse fat samples were obtained from the perigonadal regions of 7- and 67-day old mice (CD-1 strain; Charles River, Wilmington, MA, USA) and directly used for lipidomics and fluorescence imaging.
-
bioRxiv - Neuroscience 2019Quote: ... male B6;129-Nrxn3tm1Sud/Nrxn1tm1Sud/Nrxn2tm1Sud/J mice (JAX #006377) were purchased from the Jackson Laboratory and outbred once to the C57BL/6NCrl strain (Charles River, Margate, United Kingdom) to obtain mice that were individually Nrxn2α KO heterozygotes ...
-
bioRxiv - Biophysics 2022Quote: Primary cortical neuron cultures were prepared from prenatal embryos of CD-1® IGS Mouse embryos (Charles River; Strain Code: 022; RRID: IMSR_CRL:022) at embryonic day 15 (E15) ...
-
bioRxiv - Cell Biology 2024Quote: ... Block of neurotransmission was conducted and analyzed in constitutive spastin knockout 20 (SpastKO) mice (homozygous SpastKO vs controls SpastWT) and C57BL/6N (Charles River, Strain Code 027) controls injected with α-BTX ...
-
bioRxiv - Cell Biology 2024Quote: ... hippocampal pruning analysis was performed on TTLL1 constitutive knock-out 14 (named here TTLL1KO; gift from Dr. C. Janke, Institut Curie, Orsay, France) backcrossed to CD-1 (Charles River, Strain Code 022) for three generations ...
-
bioRxiv - Neuroscience 2024Quote: WT mice – Developing microglia atlas and microglial transcriptional response to MIA experiments were performed using C57Bl/6N WT mice from Charles River (strain code 027).
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...
-
bioRxiv - Microbiology 2023Quote: ... litters of mixed gender 2-day-old New Zealand White infant rabbits with the lactating doe were acquired from Charles River (Canada, strain code 052). Infant rabbits were orogastrically inoculated on the day of arrival with 109 CFU of Streptomycin-resistant strains O104:H4 C227-11 and O181:H4 17-07187 suspended in 500µl 2.5% sodium bicarbonate (pH9 ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...