Labshake search
Citations for Charles River Labs :
51 - 79 of 79 citations for Yellow Fever Virus NS1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Virus isolation was attempted for all RRT-PCR positive samples by inoculation into embryonated chicken eggs (Charles River, CT, USA) and Madin-Darby canine kidney cells (MDCK ...
-
bioRxiv - Biophysics 2020Quote: ... a 100 µ l aliquot of the 2 mg/ml Influenza A/PR/8/34 virus stock (Charles River, CT, USA) was thawed at room temperature and diluted using 50 µ l isotonic 145 mM NaCl/50 mM HEPES (pH 7.4 ...
-
bioRxiv - Genetics 2022Quote: ... Both the wild-type and PR8 mNeon-HA viruses were amplified by via injection of the respective virus into 10-day-old embryonated hen eggs (Charles River) for three days at 37C ...
-
bioRxiv - Immunology 2020Quote: ... HSV-1 was used to stimulate PBMC or pDC at an MOI of 1 and Influenza A Virus (IAV) strain PR8 (Charles River Laboratories ...
-
bioRxiv - Immunology 2019Quote: Influenza A virus A/PR/8/34 (H1N1, PR8) was propagated in 10-day-old embryonated chicken eggs (Charles River Laboratories) for 48 hours at 37°C and titered in MDCK cells ...
-
bioRxiv - Immunology 2021Quote: ... mice were lightly anesthetized with 4%v/v isoflurane/oxygen mixture and intranasally inoculated with 250 PFU of Influenza A Virus (A/PR/8/34 or IAV or PR8) (Charles River) in 50 μl volume and monitored for signs of morbidity ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus was transduced into freshly isolated Lin- bone marrow cells derived from 3 month old B6.SJL mice (from Charles River) after Lin+ cell depletion using mouse Lineage Cell Depletion Kit (Miltenty Biotec) ...
-
bioRxiv - Neuroscience 2024Quote: ... Final virus preparations were tested by silver stain of PAGE gels and Endosafe endotoxin assay (Charles River Laboratories, Wilmington, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... Sendai virus strain 52 (SeV-52) stocks were expanded in 10-days-old embryonated chicken eggs (Charles River Laboratories, Wilmington, MA) and virus titers were determined using end-point dilution tissue culture infectious dose (TCID50 ...
-
bioRxiv - Immunology 2023Quote: Influenza A/PR/8/34 virus (IAV PR8) stocks were generated using 9-day-old embryonated chicken eggs (Charles River #10100335). Eggs were incubated over night at 37 °C and candled by holding the eggs directly against a light source to identify an inoculation site without any veins above the air sac ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 ΔORF6-YFP and SARS-CoV-2 ΔORF6-YFP ΔORF3c infected CaCo-2 wild-type cells and (2) transfected HEK293T cells infected with Sendai virus (Cantell Strain) (Charles River, l0l00774) for 8 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Mice were immunized by a single intramuscular (i.m.) injection in the hind thigh with formalin-inactivated influenza A/Puerto Rico/08/34 virus (iPR8) (Charles River, Norwich, CT, U.S.A.) with or without 1mg Advax adjuvant ...
-
bioRxiv - Immunology 2024Quote: ... Cell culture supernatants containing influenza virus were harvested 7 days post-MDCK addition and blindly passaged in 8–10-day-old embryonated chicken eggs (Charles River Laboratories, Inc.). Inoculated eggs were incubated at 37°C for 48 h ...
-
bioRxiv - Immunology 2021Quote: ... NiVB and HeV challenge virus stocks were assessed for the presence of endotoxin using The Endosafe-Portable Test System (PTS) (Charles River Laboratories, Wilmington, MA). Each virus preparation was diluted 1:10 in Limulus Amebocyte Lysate (LAL ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...