Labshake search
Citations for Charles River Labs :
1 - 50 of 133 citations for Serpin F1 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The Grb10 null line was maintained on an F1-hybrid B6CBA F1/crl line from Charles River. Due to potentially confounding metabolic phenotypes associated with Grb10m/+ mice 22 ...
-
bioRxiv - Immunology 2019Quote: ... and C57BL/6 x BALB/c F1 mice were obtained from Charles River Laboratories (Margate ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... breeding stock was maintained with either a B6CBA F1/crl line from Charles River or with an in house mixed B6CBA F1/crl x B6CBA F1/J background ...
-
bioRxiv - Cell Biology 2023Quote: Timed-pregnant hybrid F1 control females were obtained by mating inbred 129/SvJ females (Charles River) and C57BL/6J males in house ...
-
Meniscal and ligament modifications in spontaneous and post-traumatic mouse models of osteoarthritisbioRxiv - Pathology 2019Quote: ... Str/ort (in-house, Royal Veterinary College, London, UK) and C57-CBA F1 mice (Charles River, UK) were kept in polypropylene cages ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: A total of 14 adult male Fischer 344/Brown Norway F1 rats (Charles River Laboratories, Wilmington, MA), 12 weeks old upon arrival ...
-
bioRxiv - Immunology 2021Quote: ... Female B6C3F1 (C57BL6 × C3/He F1) mice and nude mice (BALB/C-nu: CAnN.Cg-Foxn1nu/Crl) were purchased from Charles River Japan (Yokohama ...
-
bioRxiv - Developmental Biology 2023Quote: Animals used in this study were the F1 mice of C57BL/6j x CBA/ca hybrid (Charles River Laboratories, France). All mice were housed and bred with the approval of Vrije Universiteit Brussel’s local ethical committee (approval no ...
-
bioRxiv - Immunology 2024Quote: ... Two-cell stage embryos were surgically transferred into the oviducts of pseudo-pregnant F1 CBAxC57BL/6J surrogate females (Charles River), using 15 embryos per oviduct ...
-
bioRxiv - Developmental Biology 2023Quote: ... we generated F1 Pdgfra heterozygous mice by crossing Pdgfra heterozygous males (maintained on the original C57BL/6J background) with CD-1 (Charles River) females to improve the recovery rate of homozygous mutant KI gonads (Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... male Fischer 344 x Brown Norway F1 hybrid (FBN) rats were obtained from the National Institute on Aging colony (Charles River Laboratories) and individually housed in the Association for Assessment and Accreditation of Laboratory Animal Care International-accredited vivarium facility in the McKnight Brain Institute building at the University of Florida in accordance with the rules and regulations of the University of Florida Institutional Animal Care and Use Committee and National Institutes of Health guidelines ...
-
bioRxiv - Physiology 2023Quote: Eleven old (sacrificial age ∼33 months) and 10 young (sacrificial age ∼9 months) Fisher 344/Brown Norway F1 rats were obtained (Charles River Laboratories, Senneville, QC, Canada) with approval from the University of Guelph’s Animal Care Committee (AUP #4905 ...
-
bioRxiv - Cell Biology 2019Quote: ... DRGs were dissected from E13 mouse embryos (CD-1 IGS pregnant mouse, Charles River, #022) and dissociated to single cell suspension using Trypsin ...
-
bioRxiv - Systems Biology 2019Quote: Mouse tissues were provided by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2021Quote: ... with a female C57BL6 mouse (Charles River). Following genotypic identification (Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: A timed-pregnant mouse (Charles River Laboratories) was deeply anesthetized at E17.5 with a mixture of ketamine (200 mg/kg ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... CD-1 outbred mouse strain (Charles River) was used to obtain wildtype embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... E15.5-16.5 CD1 mouse (Charles River, France) embryo brains were dissected and washed in ice-cold 0.1M PBS containing 6.5 mg/ml glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse: BALB/cAnNCrlCrlj (Charles River Laboratories, JAX: 000651); Primers for CTENO189 ...
-
bioRxiv - Cell Biology 2022Quote: ... an adult Swiss Webster mouse (Charles River Laboratories) four or eight weeks of age and of either sex was given buprenorphine subcutaneously at a dosage of 100 µg/kg for analgesia ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse breeders were purchased from Charles River, France (the purveyor of Jackson mice in Europe ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse microglia were purified from CD1-IGS (Charles River) P0-P5 mouse pups ...
-
bioRxiv - Cancer Biology 2020Quote: ... estrogen supplemented (20) NCG mouse (Charles River, Wilmington, MA). Fulvestrant treatments began 7 days later with the following dosing regimen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: A minimal-disease certified mouse (B6, Charles River, US) was killed by cervical dislocation ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse pups (C57BL/6, Charles River, PD 1-2) were anesthetized on ice ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6N mouse lines were purchased from Charles River. The AAV vector expressing Cepheid1b-ST ...
-
bioRxiv - Neuroscience 2021Quote: Mouse studies: CD1 mice (gestation day 12.5; Charles River Laboratories) were housed (12 h dark/light cycle and less than 5 mice per cage ...
-
bioRxiv - Cancer Biology 2020Quote: ... C57Bl6 and immunocompromised mouse lines were purchased from Charles River.
-
bioRxiv - Immunology 2021Quote: ... Bone marrow cells were tested for mouse pathogens (Charles River) prior to use.
-
bioRxiv - Physiology 2022Quote: ... Mouse lines used in this study were: CD1 (Charles River), MafB-Cre (Wu et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse lines: CD-1 mice were obtained from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... to each male SCID/Beige mouse (8-week old; Charles River), 100 μL of 2.5 × 106 cells/mL in DPBS was intracardially injected ...
-
bioRxiv - Cancer Biology 2020Quote: ... To each male SCID/Beige mouse (7-week old; Charles River), 100 μL of 1 × 107 cells/mL in DPBS was intracardially injected into the left cardiac ventricle ...
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Microbiology 2021Quote: ... three- to five-day-old mouse neonates (Charles River, Wilmington, MA) were orogastrically infected with approximately 106 bacterial cells following 2 hours of separation from dam mice and maintained at 30°C for 20h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were opsonized with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...