Labshake search
Citations for Charles River Labs :
51 - 54 of 54 citations for Recombinant Rabbit IL6 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Microbiology 2023Quote: ... litters of mixed gender 2-day-old New Zealand White infant rabbits with the lactating doe were acquired from Charles River (Canada, strain code 052). Infant rabbits were orogastrically inoculated on the day of arrival with 109 CFU of Streptomycin-resistant strains O104:H4 C227-11 and O181:H4 17-07187 suspended in 500µl 2.5% sodium bicarbonate (pH9 ...