Labshake search
Citations for Charles River Labs :
1 - 50 of 54 citations for Recombinant Rabbit FGF2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Microbiology 2020Quote: ... the recombinant viruses were amplified in 10-day old specific pathogen free eggs (Charles River). Viral titers were determined by plaque assay in MDCK cells using standard techniques.
-
bioRxiv - Microbiology 2020Quote: ... The gRNAs and recombinant Cas9 (RNPs) were electroporated into zygotes of C57BL/6N mice (Charles River Laboratories). DNA from the mice generated from the electroporations was sent to the Genome Engineering and iPSc Center at Washington University in St ...
-
bioRxiv - Immunology 2019Quote: ... Rabbit anti-FCRL6 polyclonal Abs were generated by hyperimmunizing New Zealand White rabbits (Charles River Laboratories) with Escherichia coli-derived His-tagged recombinant protein.
-
bioRxiv - Immunology 2021Quote: ... the cells were washed and cultured in 48-well plates for 2 weeks supplemented with recombinant interleukin-2 (IL-2, Charles River Labs, USA) at 20 IU / mL every 2–3 days thereafter ...
-
bioRxiv - Microbiology 2020Quote: Female New Zealand white rabbits (Charles River labs) were immunized twice intra-muscularly at 14-days interval with 50 μg of purified proteins mixed with Emulsigen Adjuvant ...
-
bioRxiv - Physiology 2022Quote: ... New Zealand White rabbits (Charles River Laboratories, USA) weighing 2.8–3.2 Kg were anesthetized with sodium pentobarbital (50–90 mg/kg) ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-p27 (Charles River Laboratories, 1:1000) and mouse anti-TOX3 (Novus Bio ...
-
bioRxiv - Bioengineering 2021Quote: ... Skeletally mature male New Zealand rabbits (Charles River Laboratories) were subjected to either bilateral anterior cruciate ligament transection (ACLT ...
-
bioRxiv - Immunology 2024Quote: ... female NZW rabbit (Charles River, Saint-Constant, QC, Canada) was immunized intravenously with 0.2 ml PBS ...
-
bioRxiv - Neuroscience 2019Quote: ... Pregnant New Zealand White rabbits (Charles River Laboratories, Inc, Wilmington MA), underwent HI procedures as described in (14) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Female New Zealand White (NZW) rabbits were obtained from Charles River, France ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... ricinus colony were fed on New Zealand white rabbits (Charles River) until feeding completion (seven days ...
-
bioRxiv - Cancer Biology 2019Quote: ... and injected subcutaneously into New Zealand White rabbits (Charles River Laboratories). Rabbits were boosted once and blood collected twice over a 5 week period for 12 months ...
-
bioRxiv - Systems Biology 2022Quote: ... standard laboratory New Zealand White (NZW) rabbits (Charles River Laboratories, Wilmington, MA). At the time of testing ...
-
bioRxiv - Bioengineering 2023Quote: ... Albino rabbits (Oryctolagus cuniculus, young adult, female) were obtained from Charles River Laboratories and maintained in the WuXi AppTec animal facility according to NIH and AAALAC guidelines on an ad libitum (except during the test period ...
-
bioRxiv - Cancer Biology 2022Quote: ... This conjugate was used to immunize New Zealand white rabbits (Charles River Laboratories). Preimmune sera were obtained and booster injections of 150 µg phosphopeptide conjugate were given at 2 ...
-
bioRxiv - Microbiology 2023Quote: NZW female SPF rabbits weighing 1.1-1.4 kg were obtained from Charles River Laboratories Canadian rabbitry ...
-
bioRxiv - Microbiology 2023Quote: New Zealand white rabbits (2.5-3.5 kg) were obtained from Charles River (Canada). The animals received food and water ad libitum.
-
bioRxiv - Bioengineering 2023Quote: A total of 14 sexually mature male White New Zealand rabbits (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Microbiology 2023Quote: Female New Zealand White rabbits weighing 1.5-2 kg were received from Charles River Laboratories’ Oakwood Rabbitry ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Physiology 2022Quote: Experiments involved the use of female New Zealand White rabbits (2.1 ± 0.2 kg, Charles River) – the most relevant small animal model for cardiac arrhythmia research48 – and were conducted in accordance with the ethical guidelines of the Canadian Council on Animal Care as well as the German legislation for animal welfare ...
-
bioRxiv - Biochemistry 2020Quote: ... pathogen-free New Zealand white rabbits (3.0-3.6kg; average age 18 weeks) from Charles River Laboratories (Wilmington ...
-
bioRxiv - Biochemistry 2020Quote: ... pathogen-free New Zealand white rabbits (3.0-3.6kg; average age 18 weeks) from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Bioengineering 2020Quote: ... The stents were inserted in nine adult female New Zealand White rabbits (Charles River Laboratories, Germany) with age of 6 months and average weight of 3.5 kg ...
-
bioRxiv - Bioengineering 2021Quote: Experimental elastase aneurysms were formed in male New Zealand white rabbits (Charles River Laboratories, NY, USA) (weight ...
-
bioRxiv - Bioengineering 2019Quote: ... Four New Zealand white male rabbits (Charles River, 3 to 6 months old, 2 to 4 kg) were housed in a 12:12 h light-dark cycle ...
-
bioRxiv - Neuroscience 2022Quote: Pregnant New Zealand White rabbits (bred in house or ordered from Charles River Laboratories, Inc., Wilmington MA), underwent HI procedures as previously described (Derrick et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Pregnant New Zealand White rabbits (bred in house or ordered from Charles River Laboratories, Inc, Wilmington MA), underwent HI procedures as described in (Derrick et al. ...
-
bioRxiv - Physiology 2024Quote: ... LV CM were isolated from hearts of female New Zealand White rabbits (2.1 ± 0.2 kg, Charles River), and exposed to ...
-
bioRxiv - Biophysics 2021Quote: ... spontaneously beating SAN cells were isolated from the hearts of New Zealand rabbits (Charles River Laboratories, Wilmington, MA) as described previously (Vinogradova TM ...
-
Perivascular Excitation Tunnelling: a Novel and Preventable Cause of Cardiac Reperfusion ArrhythmiasbioRxiv - Physiology 2023Quote: ... n=105 (reperfusions)) and 2-month-old (N=31) rabbits (strain code 052, Charles River Laboratories, Romans, France). Male or female rabbits were used indiscriminately based on availability (larger rabbits ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Physiology 2023Quote: ... and female (N =15) New Zealand White rabbits (4 – 8 months old, 3.0 – 3.5 kg) were obtained from Charles River and singly housed with ad libitum access to food and water ...
-
bioRxiv - Physiology 2024Quote: ... LV CM were isolated from slices of LV myocardium from hearts of female New Zealand White rabbits (2.0 ± 0.2 kg, Charles River) according to previously published protocols.18,19
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Microbiology 2020Quote: Two-day old litters of mixed gender New Zealand White rabbits were co-housed with a lactating dam (Charles River). Infection inocula were prepared by diluting 100 μl of overnight culture into 100 mL of LB Gm ...
-
bioRxiv - Physiology 2020Quote: ... pH 7.2) and the conjugate was used for immunisation of a rabbit (70-day protocol; Charles River Biologics, Romans, France). The antigen was emulsified in Freund’s complete adjuvant for primary immunisations (∼100 nmol antigen peptide ...
-
bioRxiv - Microbiology 2021Quote: ... two-day old litters of mixed gender New Zealand White rabbit were co-housed with a lactating dam (Charles River) for the duration of the experiment ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Microbiology 2019Quote: Litters of two to three-day-old New Zealand White infant rabbits with lactating adult female (dam) obtained from a commercial breeder (Charles River, Canada or Pine Acres Rabbitry Farm & Research Facility ...
-
bioRxiv - Microbiology 2019Quote: Mixed gender litters of 2-day-old New Zealand White infant rabbits were co-housed with a lactating mother (Charles River). To prepare the EHEC transposon-insertion library for infection of infant rabbits ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...