Labshake search
Citations for Charles River Labs :
1 - 50 of 408 citations for Recombinant HIV 1 GP120 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Microbiology 2020Quote: ... the recombinant viruses were amplified in 10-day old specific pathogen free eggs (Charles River). Viral titers were determined by plaque assay in MDCK cells using standard techniques.
-
bioRxiv - Microbiology 2020Quote: ... The gRNAs and recombinant Cas9 (RNPs) were electroporated into zygotes of C57BL/6N mice (Charles River Laboratories). DNA from the mice generated from the electroporations was sent to the Genome Engineering and iPSc Center at Washington University in St ...
-
bioRxiv - Immunology 2022Quote: ... Brca1-/-luciferase-tagged cells in PBS were injected via intraperitoneal route in 8–10-week-old female C57BL/6 mice (Charles River Laboratories International Inc.). Imaging was started at day-7 post-cell injection ...
-
bioRxiv - Immunology 2021Quote: ... the cells were washed and cultured in 48-well plates for 2 weeks supplemented with recombinant interleukin-2 (IL-2, Charles River Labs, USA) at 20 IU / mL every 2–3 days thereafter ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Plant Biology 2021Quote: Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Bioengineering 2023Quote: ... For the immunogenic protein challenge experiments 9 week old female Balb/c mice were purchased from Charles River Laboratory.
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) was used to generate knockout mice ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) and Coq10a-/- mouse lines were maintained according to the University of California ...
-
bioRxiv - Cell Biology 2019Quote: CD-1 (Charles River) or C57BL/6 (JAX #000664) ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River), Myh6-Cre (20) ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Pathology 2023Quote: CD-1 (CD-1; strain #022) outbred mice were purchased from Charles River Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: In vivo immunogenicity of gB protein in combination with adjuvants was evaluated in 6–8 week old BALB/c mice (Charles River) at Aragen Bioscience (Morgan Hill ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Microbiology 2020Quote: ... male mice were paired with 1 to 2 CD-1 female mice (Charles River) each night beginning at day 5 post infection ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 mice (Charles River) were used for wild-type expression and ex vivo organ culture studies ...
-
bioRxiv - Neuroscience 2019Quote: ... CD-1 mice (Charles River). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... CD-1 (Charles River Labs), and NIH-Swiss (Envigo ...
-
bioRxiv - Neuroscience 2022Quote: CD-1 mice (Charles River) were used to produce WT mouse cortical neuron cultures as shown previously (Sathler et al. ...
-
bioRxiv - Biochemistry 2021Quote: CF-1 MEFs (Charles River) were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or human transferrin receptor KI ...
-
bioRxiv - Neuroscience 2023Quote: ... and CD-1 (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or Sarm1-deficient mice (B6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult CD-1 male mice and pregnant CD-1 dams were obtained from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... based testing of endotoxin levels of the purified proteins were performed using Endosafe®-PTS™ device and cartridges according to the manufacturer’s protocol (Charles River). Additionally ...
-
bioRxiv - Immunology 2022Quote: ... The pair of sgRNAs (final concentration 6ug/ml each) and Cas9 protein (final concentration 200 ug/ml) were co-electroporated into zygotes collected from C57BL/6J mice (Charles River Laboratory) using a NEPA21 electroporator (Bulldog Bio ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Strain CRL:CD-1(ICR) ;CD-1) male and female breeder mice were obtained from Charles River Laboratories (Raleigh ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2019Quote: ... Female CD-1 mice (Charles River) were used as foster mothers ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 (Charles River stock #022) and C57BL/6J (Jackson Laboratory stock #000664 ...
-
bioRxiv - Neuroscience 2022Quote: Pregnant mice (CD-1, Charles River) were placed in a sterile environment following (dal Maschio et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... female CD-1 mice (Charles River), with an average weight of 30.2 g and age range of 6−10 weeks old ...
-
bioRxiv - Cell Biology 2022Quote: ... CF-1 MEFs (Charles River Laboratories) were transduced with inducible STEMCCA and rtTA lentivirus–containing supernatants overnight in polybrene (8 μg/ml ...
-
bioRxiv - Developmental Biology 2019Quote: CD-1 (Charles River, Tranent, UK) mice were maintained ...
-
bioRxiv - Developmental Biology 2022Quote: ... CD-1 mice from Charles River Laboratories were used for all experiments ...
-
bioRxiv - Neuroscience 2023Quote: CD-1 mice (Charles River Laboratories) were housed under a standard light/dark cycle with access to food and water ad libitum ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River, Crl:CD1(ICR)) ...
-
bioRxiv - Systems Biology 2022Quote: CD-1 mice obtained from Charles River Germany were used for all experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and electroporated mice CD-1 (Charles River) of both sexes at postnatal 4-8 weeks-old ...
-
bioRxiv - Neuroscience 2021Quote: CD-1 mice obtained from Charles River Germany were used for all experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... CF-1 (Charles River; Wilmington, MA, US) or C57BL/6J dams (Stock # 000664 ...
-
bioRxiv - Microbiology 2021Quote: ... Female outbred CD-1 (Charles River Laboratory), 20-24 grams ...