Labshake search
Citations for Charles River Labs :
101 - 150 of 217 citations for Mouse Anti Hepatitis B Virus X Protein Antibody 1884 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Cancer Biology 2020Quote: Xenograft models were generated through the subcutaneous implant of 5×106 OE33 cells into the right-hand side of the middorsal region of the back of 16 x 52-58 day old female CB17.Cg-PrkdcscidLystbg-J SCID-Bg mice (sourced from Charles River UK). Animals were anaesthetised using 2% isoflurane ...
-
bioRxiv - Cancer Biology 2021Quote: ... Influenza virus A/PR/8/1934 (H1N1) expressing GFP from promoter x (PR8-GFP) was propagated in 10-day-old embryonated chicken eggs (Charles River Laboratories) for 48 hours at 37°C and tittered in MDCK cells ...
-
bioRxiv - Neuroscience 2019Quote: ... male Fischer 344 x Brown Norway F1 hybrid (FBN) rats were obtained from the National Institute on Aging colony (Charles River Laboratories) and individually housed in the Association for Assessment and Accreditation of Laboratory Animal Care International-accredited vivarium facility in the McKnight Brain Institute building at the University of Florida in accordance with the rules and regulations of the University of Florida Institutional Animal Care and Use Committee and National Institutes of Health guidelines ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2022Quote: ... They had unlimited chow (Rodent 5075, 18% protein, 4.5% fat, Charles River Laboratories) until 2 days before the commencement of food self-administration training ...
-
bioRxiv - Neuroscience 2023Quote: Subjects were male and female TH-Cre+/- rats bred at Memorial University using male TH-Cre+/+ (Sage Horizon) x female Sprague Dawley (Charles River, QC Canada) rats ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Biophysics 2022Quote: ... 100 µL of influenza solution (viral protein concentration from Charles River ∼ 0.2 mg/mL) was mixed in 400 µL of diluted Texas Red-DHPE suspension in HB buffer and incubated at room temperature in the dark for 2 h on a rocker ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.
-
bioRxiv - Immunology 2022Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Microbiology 2021Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Immunology 2020Quote: Endotoxin levels in protein samples were measured using the EndoSafe Nexgen-MCS System (Charles River). Samples were diluted 1:50 or 1:100 in Endotoxin-free LAL reagent water ...
-
bioRxiv - Developmental Biology 2021Quote: ... All other mouse experiments were performed on WT CD1 mice (Mus musculus, Charles River Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... WT mice used for backcrossing and mouse amplification are C57Bl6/J mice from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Cancer Biology 2022Quote: ... two-month old hairless albino mice (SKH1-Elite Mouse 477; Charles River Labs, Wilmington, MA) were divided into eight groups of 12 mice by sex ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following mouse lines in this study: Crl: CD1 (ICR) (Charles River: 022), Ai14 (Jackson Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... unfixed tissue sections (12 µm) of mouse (P60-P70; Charles River, C57BL/6; n = 2), marmoset (n = 2) ...
-
bioRxiv - Developmental Biology 2021Quote: The following mouse strains were used: C57BL/6 (C57BL/6NCrl, Charles River Laboratories, strain 027) was the wild-type strain ...
-
bioRxiv - Microbiology 2020Quote: Mouse experiments were performed with Female Swiss OF1 mice (6-7 weeks old; Charles River. All animal experiments were granted a licence by the Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden (AVD1160020173304) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Wild-type mouse neonates were obtained from timed pregnant CD1 mice (Charles River Laboratories, #022). All animal studies were approved by the Administrative Panel on Laboratory Animal Care (APLAC ...
-
bioRxiv - Cell Biology 2023Quote: Hippocampal Primary neurons were isolated from E17-E19 C57BL/6 mouse brains (Charles River Laboratories) as described in Seibenhener et al (85) ...
-
bioRxiv - Neuroscience 2023Quote: ... hippocampi were dissected from postnatal (P0-3) CD1 mouse or Sprague-Dawley rat (Charles River) pups were dissociated and plated with growth media ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: Early mouse embryos were isolated at E5.5 (from pregnant CD1 females, purchased from Charles River, UK). Following dissection from the decidua ...
-
bioRxiv - Microbiology 2021Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: Cerebral cortices from post-natal day 6 or 7 (P6/P7) CD1 mouse pups (Charles River) were collected ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse lines used in this study were: wild type (CD1, Charles River Laboratories, Strain Code #022), Cxcl12fl/fl (The Jackson Laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: All mouse experiments were performed with female NMRI or C57BL/6 mice purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse lines used in this study include CFW mice (Strain code 024, Charles River Laboratories), a βII-Specflox/flox mouse line27 ...