Labshake search
Citations for Charles River Labs :
101 - 150 of 189 citations for Mouse Anti Feline Leukemia Virus P27 Antibody 7226 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.
-
bioRxiv - Developmental Biology 2021Quote: ... All other mouse experiments were performed on WT CD1 mice (Mus musculus, Charles River Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... WT mice used for backcrossing and mouse amplification are C57Bl6/J mice from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Cancer Biology 2022Quote: ... two-month old hairless albino mice (SKH1-Elite Mouse 477; Charles River Labs, Wilmington, MA) were divided into eight groups of 12 mice by sex ...
-
bioRxiv - Neuroscience 2021Quote: ... We used the following mouse lines in this study: Crl: CD1 (ICR) (Charles River: 022), Ai14 (Jackson Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... unfixed tissue sections (12 µm) of mouse (P60-P70; Charles River, C57BL/6; n = 2), marmoset (n = 2) ...
-
bioRxiv - Developmental Biology 2021Quote: The following mouse strains were used: C57BL/6 (C57BL/6NCrl, Charles River Laboratories, strain 027) was the wild-type strain ...
-
bioRxiv - Microbiology 2020Quote: Mouse experiments were performed with Female Swiss OF1 mice (6-7 weeks old; Charles River. All animal experiments were granted a licence by the Competent Authority after an advice on the ethical evaluation by the Animal Experiments Committee Leiden (AVD1160020173304) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Wild-type mouse neonates were obtained from timed pregnant CD1 mice (Charles River Laboratories, #022). All animal studies were approved by the Administrative Panel on Laboratory Animal Care (APLAC ...
-
bioRxiv - Cell Biology 2023Quote: Hippocampal Primary neurons were isolated from E17-E19 C57BL/6 mouse brains (Charles River Laboratories) as described in Seibenhener et al (85) ...
-
bioRxiv - Neuroscience 2023Quote: ... hippocampi were dissected from postnatal (P0-3) CD1 mouse or Sprague-Dawley rat (Charles River) pups were dissociated and plated with growth media ...
-
bioRxiv - Microbiology 2024Quote: Mouse fecal samples were collected from nine female C3H/HeN mice purchased from Charles River Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: Early mouse embryos were isolated at E5.5 (from pregnant CD1 females, purchased from Charles River, UK). Following dissection from the decidua ...
-
bioRxiv - Microbiology 2021Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: Cerebral cortices from post-natal day 6 or 7 (P6/P7) CD1 mouse pups (Charles River) were collected ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mouse lines used in this study were: wild type (CD1, Charles River Laboratories, Strain Code #022), Cxcl12fl/fl (The Jackson Laboratory ...
-
bioRxiv - Molecular Biology 2020Quote: All mouse experiments were performed with female NMRI or C57BL/6 mice purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse lines used in this study include CFW mice (Strain code 024, Charles River Laboratories), a βII-Specflox/flox mouse line27 ...
-
bioRxiv - Neuroscience 2022Quote: Cortical neuron cultures were prepared either from wild-type CD1 mouse embryos purchased from Charles River or from heterozygous crosses between PFTK1 mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... Each rAAV were test in separate B6 albino mouse (B6N-Tyrc-Brd/BrdCrCrl, Charles River, MA) through retro-orbital injection ...
-
bioRxiv - Physiology 2023Quote: ... Female BALB/cByJ (age 5-8 weeks; weight ≈20g per mouse) were acquired from Charles River® Laboratories (Barcelona ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2023Quote: ... OT-1s are tested via PCR for a comprehensive list of mouse pathogens by Charles River Laboratory Testing Management ...
-
bioRxiv - Physiology 2024Quote: All mouse experiments were carried out in C57BL/6 male mice purchased from Charles River (Germany). Mice were housed in groups of 4 in ventilated cages with a 12 h light/12 h dark cycle in a temperature-controlled (20-24°C ...
-
bioRxiv - Biophysics 2024Quote: ... Pancreatic spheres were prepared from the dissection of E13.5 embryos (mouse CD1 from Charles River Laboratory) using the protocol reported in Greggio et al38 and used without passaging.
-
bioRxiv - Microbiology 2024Quote: Mouse Model: Five- to six-week-old female C57BL/6J mice were acquired from Charles River Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: Mouse eyes were collected from male and female 12-week-old CD1 mice obtained from Charles River Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse primary cortical neuron cultures were prepared from gestational day 15 C57BL/6 embryos (Charles River Laboratories), as described previously (Zheng 2010) ...
-
bioRxiv - Developmental Biology 2019Quote: Mouse oocytes were collected at the germinal vesicle stage from the ovaries of CD1 females (Charles River) aged ∼3months ...
-
bioRxiv - Cancer Biology 2019Quote: ... after which 200 μL were injected into the tail vein of a Balb/c mouse (Charles River). Mice were anesthetized with isoflurane immediately after injection and terminal cardiac blood collection was performed ...
-
bioRxiv - Bioengineering 2019Quote: An 8-week-old nude female mouse (nu/nu, strain code: 088, Charles River Laboratories, MA, USA) was used to test needle guidance with GNR injection using a well-defined protocol ...
-
bioRxiv - Genetics 2021Quote: All null allele mouse lines were produced in the C57BL/6N strain background available from Charles River, the Jackson Laboratory ...
-
bioRxiv - Genetics 2020Quote: All mouse experiments were performed with C57BL/6J mice obtained from Charles River (Charles River Laboratories, France). All mice were housed in a temperature-controlled system and maintained on a 12-h light/dark cycle (lights on at 7 a.m.) ...
-
bioRxiv - Neuroscience 2022Quote: ... Outbred strain CD1 mouse pups used for some in utero electroporation experiments were ordered from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2023Quote: ... Mouse models carrying orthologous mutations of SLE patients were generated in C57BL/6 mice (Charles River Laboratories) via CRISPR-Cas9 genome editing technology according to Jiang et al ...
-
bioRxiv - Neuroscience 2023Quote: ... All CPN were isolated and purified from wildtype CD1 mouse pups of both sexes (Charles River Laboratories), enabling subtype-specific expression of fluorescent proteins using unilateral in utero electroporation at embryonic day 14.5 (E14.5) ...
-
bioRxiv - Genomics 2020Quote: ... Wild-type mouse strains were bred from stocks in-house or otherwise supplied by Charles River (L’Arbresle, France) or MRC Harwell ...