Labshake search
Citations for Charles River Labs :
1 - 50 of 127 citations for Mouse Anti Chlamydia LPS 1645 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Biochemistry 2021Quote: ... all protein samples were brought to a final volume of 200 μL and the LPS content was measured using a commercial kit from Charles River Endosafe (R160) ...
-
bioRxiv - Cell Biology 2019Quote: ... DRGs were dissected from E13 mouse embryos (CD-1 IGS pregnant mouse, Charles River, #022) and dissociated to single cell suspension using Trypsin ...
-
bioRxiv - Systems Biology 2019Quote: Mouse tissues were provided by Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2021Quote: ... with a female C57BL6 mouse (Charles River). Following genotypic identification (Transnetyx ...
-
bioRxiv - Neuroscience 2023Quote: A timed-pregnant mouse (Charles River Laboratories) was deeply anesthetized at E17.5 with a mixture of ketamine (200 mg/kg ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... CD-1 outbred mouse strain (Charles River) was used to obtain wildtype embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... E15.5-16.5 CD1 mouse (Charles River, France) embryo brains were dissected and washed in ice-cold 0.1M PBS containing 6.5 mg/ml glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse: BALB/cAnNCrlCrlj (Charles River Laboratories, JAX: 000651); Primers for CTENO189 ...
-
bioRxiv - Cell Biology 2022Quote: ... an adult Swiss Webster mouse (Charles River Laboratories) four or eight weeks of age and of either sex was given buprenorphine subcutaneously at a dosage of 100 µg/kg for analgesia ...
-
bioRxiv - Neuroscience 2020Quote: ... The mouse breeders were purchased from Charles River, France (the purveyor of Jackson mice in Europe ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse microglia were purified from CD1-IGS (Charles River) P0-P5 mouse pups ...
-
bioRxiv - Cancer Biology 2020Quote: ... estrogen supplemented (20) NCG mouse (Charles River, Wilmington, MA). Fulvestrant treatments began 7 days later with the following dosing regimen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: A minimal-disease certified mouse (B6, Charles River, US) was killed by cervical dislocation ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse pups (C57BL/6, Charles River, PD 1-2) were anesthetized on ice ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6N mouse lines were purchased from Charles River. The AAV vector expressing Cepheid1b-ST ...
-
bioRxiv - Neuroscience 2021Quote: Mouse studies: CD1 mice (gestation day 12.5; Charles River Laboratories) were housed (12 h dark/light cycle and less than 5 mice per cage ...
-
bioRxiv - Cancer Biology 2020Quote: ... C57Bl6 and immunocompromised mouse lines were purchased from Charles River.
-
bioRxiv - Immunology 2021Quote: ... Bone marrow cells were tested for mouse pathogens (Charles River) prior to use.
-
bioRxiv - Physiology 2022Quote: ... Mouse lines used in this study were: CD1 (Charles River), MafB-Cre (Wu et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse lines: CD-1 mice were obtained from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... to each male SCID/Beige mouse (8-week old; Charles River), 100 μL of 2.5 × 106 cells/mL in DPBS was intracardially injected ...
-
bioRxiv - Cancer Biology 2020Quote: ... To each male SCID/Beige mouse (7-week old; Charles River), 100 μL of 1 × 107 cells/mL in DPBS was intracardially injected into the left cardiac ventricle ...
-
bioRxiv - Cancer Biology 2020Quote: ... For each male SCID/Beige mouse (7-week old; Charles River), 100 μL mixture was subcutaneously injected into both flanks ...
-
bioRxiv - Microbiology 2021Quote: ... three- to five-day-old mouse neonates (Charles River, Wilmington, MA) were orogastrically infected with approximately 106 bacterial cells following 2 hours of separation from dam mice and maintained at 30°C for 20h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A Male Balb/C mouse weighing 25 g (Charles River, UK), allowed free access to standard rodent chow and water ...
-
bioRxiv - Microbiology 2019Quote: ... Bacteria were opsonized with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were opsonised with 10% BALB/c mouse serum (Charles River) in 10 volumes of DMEM for 30 min on ice.
-
bioRxiv - Cancer Biology 2023Quote: ... For each male SCID/Beige mouse (7-weeks-old; Charles River #CRL:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used the following mouse lines: CD1 (ICR) (Charles River: 022) and Ai14 (Jackson Labs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Experiments were performed on outbred strain CD1 mouse pups (Charles River Laboratories). Analyses are thought to include animals of both sexes at approximately equal proportions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse experiments: 6-8 weeks-old female BalB/c mice (Charles River) were used in all experiments ...
-
bioRxiv - Neuroscience 2021Quote: The C57BL/6J mouse line was used as background strain (Charles River). Mice expressing Cre from the Pitx3 locus and Cre induced YFP from the Rosa26 were previously described (35 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Neuroscience 2022Quote: Primary cortical neurons were prepared from C57BL/6J mouse embryos (Charles River) of either sex on embryonic day 17 ...
-
bioRxiv - Immunology 2023Quote: ... B6.SJL-PtprcaPepcb/BoyCrl (CD45.1) mouse stain was obtained from Charles River Laboratory ...
-
bioRxiv - Neuroscience 2023Quote: Primary DRGs were cultured from E13.5 CD1 mouse embryos (Charles River Laboratories). DRGs were dissected in DMEM ...
-
bioRxiv - Cell Biology 2024Quote: The mouse strains used in this study were purchased from Charles River Laboratories (ICR mice ...
-
bioRxiv - Neuroscience 2020Quote: ... Embryos (aged E12.5 - E16.5) of the mouse strain ICR (CD1, Charles River Laboratory) were used for in utero experiments and primary culture ...
-
bioRxiv - Neuroscience 2019Quote: Hippocampal neuronal cultures were prepared from C57BL/6J mouse embryos (Charles River Laboratories). UPF2-shRNA 1 virus is on a piLenti-shRNA-GFP backbone carrying one shRNA against the UPF2 mRNA (AGGCGTATTCTGCACTCTAAAGGCGAGCT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Hippocampi were isolated from postnatal day 0 (P0) CD-1 mouse (Charles River) brain tissues and digested with 10U/mL papain (Worthington Biochemical Corp ...
-
bioRxiv - Neuroscience 2021Quote: ... DRG was dissected from embryonic days 13.5-14.5 CD1 mouse (Charles River Laboratories) and incubated with 0.05% Trypsin solution at 37 °C for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: The following mouse strains were used in this study: C57BL/6 (Charles River), Sirt2flox 57 ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary mouse myoblasts (mskMPs) from 3-week-old C57Bl6/J (Charles River, C57BL/6NCrl) mice were maintained in collagen I coated dishes (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... All mouse lines were in the C57BL/6J background (>10 generations, Charles River, USA), besides Scn1a+/− mice that were in a mixed background (C57BL/6J-CD1 85:15%).
-
bioRxiv - Neuroscience 2021Quote: ... Biological specimens for imaging were obtained from a C57Bl6 mouse (Charles River Labs, UK) expressing mCherry sparsely in neurons of the Lateral Posterior nucleus (LP ...
-
bioRxiv - Neuroscience 2021Quote: ... The following mouse strains were used: wild type (C57BL/6N, Charles River Laboratories #027), Ai14 (JAX ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... and the resident was a white coat-coloured CD-1 mouse (Charles River, #022). For the rat resident-intruder protocol ...
-
bioRxiv - Genetics 2020Quote: ... We isolated mouse connective tissue from 8–10 week old CD1 mice (Charles River), intervertebral discs (IVDs ...
-
bioRxiv - Cell Biology 2022Quote: Mouse lines used for time-course experiments: C57BL/6 wild type (Charles River Laboratories), one 12 weeks old male and one 8 weeks female mice.