Labshake search
Citations for Charles River Labs :
401 - 450 of 820 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade C 16055 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Xenografts were established in male athymic BALB/c (nu/nu) mice (6–8 weeks old, 20-25 g; Charles River) by subcutaneous injection of LNCaP-AR or 22Rv1 cells (1-5×106 cells ...
-
bioRxiv - Immunology 2022Quote: Specific pathogen-free (SPF) BALB/c female mice (6-8 weeks old) for immunogenicity studies were purchased from Charles River Experimental Animals Co. ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 × 106 HCT116 or SW480 cells were implanted subcutaneously in 6-week-old female BALB/c nude mice (Charles River). For MC38 cells ...
-
bioRxiv - Immunology 2021Quote: ... Recipient mice for transplant experiments were female BALB/c mice (CR:028 from Charles River, age 8 weeks or older). Recipient mice for chimera experiments were Thy1.1 mice (B6.PL-Thy1a/CyJ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Female C57BL/6 mice (4-6 weeks) and male BALB/c mice (10-12 weeks) were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... Intruders used were group-housed BALB/c males or group-housed C57BL/6 females (both 10-36 weeks, Charles River). Mice were housed at 18-23 °C with 40-60% humidity and maintained on a reversed 12-h light/dark cycle (dark cycle starts at 10 a.m. ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells as single cell suspension (2×104 cells in 10 µL) were injected into the deep dermis of Balb/c nu/nu mice (Charles River) carrying a dorsal skin-fold chamber ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1×107 serum-treated META L.mexicana cells were injected in rumps of 8-12 week old Balb/c mice (Charles River, UK). After 4 months the mice were sacrificed and the lesions harvested as described [6,24] ...
-
bioRxiv - Cancer Biology 2021Quote: GIST-T1 cells were bilaterally injected in the flank of 12 female adult athymic nude mice (BALB/c nude mice; Charles River Laboratories 35 ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... Mice with a genetic deletion in Endo180 (Mrc2)17 were backcrossed for at least six generations with either BALB/c or C57BL/6 (Charles River) mice ...
-
bioRxiv - Immunology 2021Quote: Pooled sera from pregnant and non-pregnant women were transferred intraperitoneally into naïve female Balb/c mice (Charles River, Wilmington, MA) at 0.2 ml/mouse ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For our experiments 9-12 months old adult B6/j-Rj mice (n=23) and white BALB/c mice (n=3) were obtained from Charles River, Germany ...
-
bioRxiv - Microbiology 2020Quote: LPS-free and sterile filtered pyocin S5 or pyocin AP41 in PBS were injected intravenously (IV) at a concentration of 1mg/mL in 8-10 weeks old female Balb/c mice (Charles River). Mice were culled at different time points following the injection (earliest 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... 2 glass coverslips were surgically implanted over the 4th right mammary gland of 8-12 week old female BALB/c (Charles River) 43.
-
bioRxiv - Cancer Biology 2022Quote: ... 1 × 104 4T1-VC or 4T1-KMT5C cells were injected orthotopically into the mammary fat pad of BALB/c mice (Charles River). The mice were euthanized four weeks after tumor cell implantation ...
-
bioRxiv - Biochemistry 2023Quote: We used the following mix-gender animals for the wildDISCO study: 4-week-old wildtype mice (C57BL/6J, CD1 and Balb/c) purchased from Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eight- to 10-week-old nu/nu female or male mice and 4 to 6-week-old Balb/c female or male mice were obtained from Charles River Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... and gsh2Δ::GSH2 strains was tested in a murine inhalation model of cryptococcosis using female BALB/c mice (4 – 6 weeks old) from Charles River Laboratories (Ontario ...
-
bioRxiv - Immunology 2024Quote: Male and female mice (C57Bl/6, Balb/c and B10.BR) 8 to 24 weeks of age were purchased from Charles River Laboratory (Boston ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins were tested for LPS content by the chromogenic Limulus amebocyte lysate assay (Endochrome; Charles River), and the endotoxin content was less than 0.01 U per microgram of recombinant proteins.
-
bioRxiv - Cancer Biology 2021Quote: ... 5×104 cells in PBS were injected in the fourth mammary fat pad at the base of the nipple into female Balb/c (Charles River, France). From Day 6 ...
-
bioRxiv - Cancer Biology 2019Quote: 4T1 cells (1×105 in 50 μL) were injected into the 4th mammary fat pad of Balb/C 8-week old female mice (Charles River Laboratories) as previously described (Ilina et al. ...
-
bioRxiv - Cancer Biology 2020Quote: Subcutaneous flank tumors were established in 6-8-week-old female nu/nu mice (Duke University CCIF) or BALB/c mice (Charles River Labs) through injection of 5×105 67NR murine luminal breast cancer cells in 100 μL of serum-free RPMI (VWR) ...
-
bioRxiv - Microbiology 2022Quote: ... we used the transgenic GFP P.berghei parasites (ANKA 2.34 strain) kept by serial passages into 3-4 weeks old female BALB/c mice (Charles River, Wilmington, MA) starting from frozen stocks ...
-
bioRxiv - Bioengineering 2023Quote: The system was tested on white (or albino) hairy mice of the B6 and BALB/c strains (Charles River Laboratories Japan, Japan). Experiments on healthy mice were performed using 9-week-old female mice ...
-
bioRxiv - Immunology 2023Quote: Wild-type (BALB/c or C57BL/6J) mice were obtained from a commercial supplier (Envigo, Hillcrest, UK or Charles River, Margate UK). Il13eGFP(C57BL6/J)52 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tumor inoculation was performed by injecting 5 × 104 4T1 cells in a volume of 50 μL of sterile PBS into the number four inguinal right MFPs of 8-to 10-week old female Nu/Nu or Balb/C mice (Charles River Laboratories). In CD8+ T cell reduction experiments ...
-
bioRxiv - Bioengineering 2023Quote: ... 1×107 PANC-1 cells in 150 μL of 1×PBS were injected in the right flank region of the mice (BALB/c nude, female, 4-5 weeks old, Charles River, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... CB5083 (15-25 mg/kg/day) was given to male BALB/c mice (8-10 weeks of age, n = 3 animals/group, Charles River Laboratories) by oral gavage (OG ...
-
bioRxiv - Cancer Biology 2023Quote: 3 × 106 H460 cancer cells in 100 µL PBS were injected subcutaneously into female Balb/C nu/nu mice aged 6-9 weeks (Charles River Laboratories). Tumour growth was monitored using an electronic caliper and the volume calculated using the following equation ...
-
bioRxiv - Microbiology 2021Quote: ... Viruses were grown and amplified in 10-day-old specific-pathogen-free research grade chicken embryos at 35°C (Charles River Laboratories; SPAEAS).
-
bioRxiv - Cell Biology 2019Quote: ... 3 × 106 viable A375 cells in 100 μl PBS were injected into the 6–8-week-old female athymic mice (BALB/c; Charles River, Beijing, China). One week after inoculation ...
-
bioRxiv - Bioengineering 2022Quote: ... Five million cells were injected into the right flank of six- to eight-week-old Balb/c mice (Charles River Laboratories, Wilmington, USA). Mice were housed in the Laboratory Animal Facility of the Stanford University Medical Center (Stanford ...
-
bioRxiv - Immunology 2024Quote: ... Female BALB/c mice of 11-16 weeks with body weight between 19 and 24 g were used for the experiments (Charles River, Sulzfeld, Germany). The local animal facility environment had a temperature of 22°C and a humidity of 45-60% followed a 12-hour light/dark cycle ...
-
bioRxiv - Cancer Biology 2024Quote: ... were mixed with Corning Matrigel® matrix growth factor reduced and subcutaneously injected into flanks of 8-week old male BALB/c Nude mice (Charles River Laboratories) as previously described21,30 ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified proteins for immunogenicity study were tested for endotoxin levels using Limulus Amebocyte Lysate (LAL) cartridges (Charles River PTS201F).
-
bioRxiv - Cancer Biology 2023Quote: A suspension of 100 µL PBS containing a total of 3 × 106 NCI-H460 Fluc cancer cells was injected subcutaneously into female Balb/c nu/nu mice aged 6 to 9 weeks (Charles River Laboratories, n = 20). Tumor dimensions were measured using calipers and the volume calculated using the following equation ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) was used to generate knockout mice ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) and Coq10a-/- mouse lines were maintained according to the University of California ...
-
bioRxiv - Cell Biology 2019Quote: CD-1 (Charles River) or C57BL/6 (JAX #000664) ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River), Myh6-Cre (20) ...
-
bioRxiv - Microbiology 2022Quote: ... berghei (ANKA strain) that constitutively expresses green fluorescent protein (GFP) was maintained via serial passage in ICR mice (Charles River Laboratories Japan Inc. ...
-
bioRxiv - Immunology 2024Quote: ... Purified proteins were confirmed to be endotoxin-free (<0.1 EU per dose) using the Endosafe Nexgen-PTS system (Charles River). Purified proteins were flash-frozen in liquid nitrogen and stored at -80C until use.
-
bioRxiv - Pathology 2023Quote: CD-1 (CD-1; strain #022) outbred mice were purchased from Charles River Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... a single guide RNA targeting the sequence GTGAAATCCAACCAATTCCA sequence within exon 5 of Scn2a was mixed with Cas9 (S. pyogenes) protein (QB3 MacroLab, UC Berkeley) and injected into the pronucleus of fertilized Long Evans (Crl:LE, Charles River Laboratories) embryos ...
-
bioRxiv - Microbiology 2020Quote: ... male mice were paired with 1 to 2 CD-1 female mice (Charles River) each night beginning at day 5 post infection ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 mice (Charles River) were used for wild-type expression and ex vivo organ culture studies ...
-
bioRxiv - Neuroscience 2019Quote: ... CD-1 mice (Charles River). Briefly ...